GenePrediction:GLEAN_8063 Details

Name: GLEAN_8063
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1296057..1295511 (- strand)
Length: 547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1296057..1295845 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_113:1295657..1295511 (- strand)
Length: 147
>GLEAN_8063 class=GenePrediction position=GCSC_113:1296057..1295511 (- strand)
ATGGATAGCATCATGTCTGGTGCTTCTGTCGACGAACGAGCAGAGAGCCAGGCGACGTGCGCTAGGGCTATAGCGTTCGC
GAGCGCTGAGGACAGGGAGGCAGCAGAAGGGGGGGACACGGAAGGGAGACAGAAGGAGCATGCTCAAAGGAGGGGACGTA
CCCACTTTGCTCTTCGAGAAGAAAGGCAGCCCGATGCTGATCAATCCCTCGCAGTGAGACCGTGTTGACAGGAGCGGCTA
TCGAAGGCGGTCCAGAAGGCTTCTGCAGCGCTAGAGAAGCGAGTGGAAGTGCTGTTGGGGGGCCGTTTACCATTCGTTTG
CATGGCACCATCAGCCTGCAGGCAGAGCCAATGCAGCAGAAGGGAGTTCTCGTTCTTCTTTTGCTTCTTCCTGCCTCAAG
GCCTGTGAGGAGCCCGTCGAGCACCAAATAGGCAATGGCTCCGGAATGGAGTCGAGGTGGATCCGCATGCAGGACAACAA
GAAAAAGGGAGGCGTCCAAGGGGACTGCTGCTCTGCCTGCTGCGATAGGCCCCTTCTTGCGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62