GenePrediction:GLEAN_8064 Details

Name: GLEAN_8064
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1289942..1288588 (- strand)
Length: 1355
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1289942..1289902 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_113:1289841..1289676 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_113:1289631..1288588 (- strand)
Length: 1044
>GLEAN_8064 class=GenePrediction position=GCSC_113:1289942..1288588 (- strand)
ATGCAAACATCTTCCAACGCACAGCACTTCTTTGAGACTGAGTATGGCTATGACTTCCCTCAGTAGTCTGCATGCAAAAC
TAAGACCTGTCCGCTCCCCAGTGCTTCACAAGAGAAGCGAGAGCGCCGCGCCGCCAAGTCGACCAACAAGTATGGCAACC
CGGTCGCCCTAAAGTCCAAAGTGCTGGCAGTCATTGCCGATCCGACCTCTGCTTCACACGTGTTCATCGCCGAGTCGGCC
GGCTCTGCGCGGAGAGTCAACATTGATGTAAGCGCACAGACACGCCGACGATCAATCACGCTGACCTCCAGGATGCAAAT
GCCGCCACGGCCGCATACCGCGGCCCCACGACGCCAGTGACCAGCCTCGCGCTGGGCAGCACGAGCACCAGCTGCACGCT
CTTTGCTGGCTGCTGGGACAAGACGGTGTGGTCCTGGGACCTGGCCACGCGTGTGGTCGGTCGCCGGTACGTCGGCCATG
GCGACTTTGTCAAGGCGGTCGTGTGCGGGCAGCTGGGCGGCCAGGCCGTGTTGATCAGCGGTGGTGCTGACAAGAAGATC
ATCGTCTGGGACGTGGCCACGGGCCGGCGCCTGCACACGCTGCAGGACAAGACGGGCGGACCGGCCATGATGGCCGTGCA
GGACCTGGCAATCGACCCGGTGGCCACAACGGCCGACGAGCTATGGCTGGTGAGTGCCAGCAGCGACCCGCACATCCGGC
GTATTTGGCGCATCCGGCCGGATGGCTGGGAGCAGGTGGAGGACGCTGCTGAGACTGCTGAGACTGTTGCAAACACGGCT
GCGGCTGCGGCTGCTGGGCCTCGTCGGACCCTGCTGGCCCACGAGACGACCGTCTACAAGCTGCTCTTTGAGGACTTTGC
CGACGGCGACGGCCAGGACATTGATCTGTGGACGTGCAGCGCTGACGGCACGACCAAATGCCTCTCGCGGATACACGGCT
TCGCCGACGGTAGCGACACGCTCGCGCACGGCGACCATGTTCGCGCGGTGGCCGTCACGGACGCCTGGGTCGTCACGGCC
GGTCGCGACGAGGACGTCCAGTTTTGGGACCGCGCCACTGGCCGCCGCTACGCCACGCTGGCCGGCCACTTTGACGAGAT
CACCGGCATCACCGTCCTGGCCGACCGCCGACGACTCTGCAGCGCCAGCCTGGACGGCACACTGCGTACGTGGCCACTGG
ACCGTGCCGGCCTGGATGACCTGGTGCGCCGGCAGGAGGAGGACCTGAAGGATGACGCGTCCCCAGCAGCAGAAGAAGCG
GCAGCAGAAAAAACAGAGGATGGGCTGACGGTCGAAGAGGAGGCCGAGCTCGCAGCCTTGATGGAGGACGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62