GenePrediction:GLEAN_8067 Details

Name: GLEAN_8067
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1270034..1266838 (- strand)
Length: 3197
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1270034..1269975 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_113:1269637..1269519 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_113:1268577..1268202 (- strand)
Length: 376
Type: CDS
Source: GLEAN
Position: GCSC_113:1268097..1267441 (- strand)
Length: 657
Type: CDS
Source: GLEAN
Position: GCSC_113:1267389..1266838 (- strand)
Length: 552
>GLEAN_8067 class=GenePrediction position=GCSC_113:1270034..1266838 (- strand)
ATGGTCGACGTTGCGGTGAAGCTCGACGGAAAGCTGTCGTCTCGCGATCGGTTCTCGGGGGTAGGATTCGCTTCGATAGC
GCGGCAGCTGGATGGGCAGGAAAATTCAGATTAAAAAAGGGAGGAGCGCAGAGAAAAAAAAAGTCAAAGGTAAAACCCAA
ACTCCTGCAGCGCGAATAGCAACGCGGGAAGCCCACAAAGCAGAGACGGCAGACAGAGGTCGAGAAAGTCGGGGGGTTTT
TTCTTGGCGCGTTAAGAGGTTTAGCGCGTTGTCCTTCCTGCAACTGAATTTCTGTCTATGAACAAGTAATTGCAATGGCT
GGGCTCAACCGAATTGGGAAAGGCGCTGAGTATGCGGGCCAATAGGAGAGCCACTAAATTTGCTTGAAACCTGACAGAGC
GCAAGTTTGGACGAGCGCATCGTCTTGTGTCTCTTTGCGCTGCCGCTTCCTGTGTCCGCCACGCTTGCGCCATCGATCCT
GTCGCCGGCGACAATTGTCCGCGACGATGCAGCCACGTACGCGACCGATTCAGCGGGTTGCCGCGGCCGTCGCCACCTGT
CCTGCCGAGGTATGAGAAGGGAGAGGGAGAAAGGAGGAGAGGGAGGAAGAAGAAGGAGAAGGAAAGATGAGGAGAAGAGA
AGAAGAGAGCGAAAAGACGGGGAGAAAGAGGACAAAGAGAAGAAGAGAAGAAAATGTCAAACTGAAAAGATCTTGCTAAC
TGGACAGGCTTCCGCTTACGGCAAATGCATCGTGGCCGACTACAACTCCGTCCACAAGGACAAATGTGCGACTGAGTTTC
TGAAGCTGAAAAACTGCTACCTGGTGCGTGGAAGCTCGAGCGGAAAGACCGTTGCAGGAGCTGACTTGAGCAGGCAGCCA
TGAAGAAGGGCCGTTGAGGAACAGTTGCGGTCTGCTTACAGGGTGCTGGGTGCGGAGTGGGTGCTGAAAGACTGGACACG
GCTTGTGGACGCAAACGCCATCATCGGCTGACTGGCTGAGGACCTACGTTTGAAAGTGACATGTTCTATTCTGGACAGCT
GCAGAATAGAGACAATTCAGGCTGGCATACCGGCCAGTAGACGTGTCTACGTTCAAGCTGGACGGCAGAGAAGACAACGA
GAATACGTTTGAATGCAAAAAGACCAAACAAGACGCTGTAACCAAAAAAAAAAATACCCGAAATAACGTACAGGCCACTC
CCAGAAGACTCCGACAAGGCTGCATCACCATGTGCCGTAAATGACATGTTTAGCGCGCTGCAGCCCACCAATAGCCGCTG
CTGGCGCACGCCCCAACGCGCCAGATACCCCCGCCATCAGGCGTCAGGCCTGTTCCCCCAGCAGGCCGTTGCTGTGATGG
AGGGGTTCCCAGAGGGACAACAAAAACAAGGGACGGAGTAAATAAGAGCAGGAATAAATAAAATAGGCAAAATATTCAAA
ATATTCACCGTTCAAAGCGTAAAGCGTCCGAATCACGATCCCGGATCCCCACGACTCTGGAGGCACCCACCACCGCACTA
CCTCACAGCCCTCGACCCTGATCGGTCGACCTCGACAAGTTGTCCGTGCAGCATCGACCACCCGCCCCGCTCGCTGGCCG
CTCGCCGCTTTGGGCAGACGCCGCCGTCTCCCTGTCGTCCTGTCGTCCTGTCGTCCTGTCGTCCTCTTACCGGCTTCGTC
TTCTCGCTCGGCCTGTTCTTGTCCCCGACACTGTCGTCCGCCATGTCCTTCTTCTTCGGTCGCGGCCGCAGCCGGACCAA
TGCGGCCGAGCTGGCCAGACAGACGTACGACCTCCTTGTCCGCTTGGATCTGCCGCGGAATCCGAGTCCAAAGGTGTGTC
TTTCTTTTCGGTTTTCTTTCTTTTCGGTTTTCTCTCTTTTCAGGTTTCTTTCTTCTTCCCCTCACTCTCGTTCCTCCTAA
CCCCTGTGCCATTTCAGCTCGACGACTCCCTCCCGAAATGTCTCGCCCAGATGAAAGCCATCCTCCAGGGATCACCCGAA
GTCGACAGCAGCCCCGAACAGGTTTACCAGCTCGTGCAGGGCATCATCGACGAGCAGGTGCTGCTGCTGCTGCCCCAGGC
CCTGCGTCTGCTGCCCTTTGAGTCGCGCAAAGACGCCCAGGTGGTCTTCTCGTCCGTCTTCCGCTATCGACCTCCTGGCA
CTCCCCCTACCGATCCACCGCTCGCCGTCAGCTTCGTCACTCATCGCGCTCCCTCCGTCCTCGTCGCCCTCTGCCACGGC
TACGACCACAAGGAGAGTGCCACCACGGCCGGCTCCATCCTGCGTGAAGTTCTCAAGCACGAGGCTGCTGCTGCCGTCGT
GCTGTATGACGATGTCGAGGCTATCAGCGCTGACGAGGCTGCTGCCACACCGGAACAACAGCAACAGCAACAACAGCTGC
AGGACGGCAGTGGAATGCCTCTGCCTGCACCGCCTCCACAACAGCCGCGGCCGGCTGTCGGGTCCAGTGCCGGCGGCGTC
TCGCAGATCGCCATGCTGCGACTGCAGAGCGGCCGAGGTGTCTTTTGGCAGTTCTTCCGCTGGATCGACACCAGCTCGTT
CGAGGTCGCTGCTGATGCCTTCACGACGTTCCGAGTCCGTGTCCCTTGTTACCTGCCCACTCCACGGACGCTGACCTTCC
TCTAGGAACTCCTCACTAGGCATAAGGAGCTCGTGCCGCAGTATCTCAGCGTCAACTTTGACCTCTTCTTCGGACGCTAC
AACACGACGCTCGTGCTGTCGCAGAGCTACGTCACCAAGCGCCAGTCTATCAAGCTGCTCGGCGAGATCCTGCTCGACCG
CTCCAACTACAGCGTCATGACACGCTACGTCGACAGCGGCGAGCACCTCAAGATCTGCATGAACCTGCTGCGCGACGATC
GCAAGATGGTCCAGTACGAGGGCTTTCACGTCTTCAAGATCTTTGTGGCCAACCCCAACAAGAGCATCGCCGTCCAGAAG
ATCCTCATCATGAACCGTGACAAGCTGCTCAACTTCCTGTCCCACTTTCTCGAGGAGCGCACTGAGGACGAGCAGTTTCT
CGACGAGCGCGAATTCCTCATCAAGCAGATTCGCAACATGCCGCCCAAGCCCCGACGATGCCGCCGCAGCGCTGAGCGGG
GCTGTCTTTCCTCCATCGCTTTGTGTACTCTTTCTGTTGCTCTCTTTTCGTGTCTCTCTATCTCTTTGTTTCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62