GenePrediction:GLEAN_8068 Details

Name: GLEAN_8068
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1261777..1258586 (- strand)
Length: 3192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1261777..1261628 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_113:1261559..1261462 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:1261022..1259888 (- strand)
Length: 1135
Type: CDS
Source: GLEAN
Position: GCSC_113:1259836..1259068 (- strand)
Length: 769
Type: CDS
Source: GLEAN
Position: GCSC_113:1259007..1258586 (- strand)
Length: 422
>GLEAN_8068 class=GenePrediction position=GCSC_113:1261777..1258586 (- strand)
ATGGCATCCAAGCGAAAAGTGGCAGCGATGGCTGCCACGCTGGAGGAGCCTGTCGATCCCTCTGACGAACTCATGTTCCT
GTGTCTAGGTGGCGGAAACGAGGTTGGCCGGTCCTGTCATATCATACAGTACAAGGGGAAAACGGTCATGGTAAGACAAG
TGACATGCGTACATTACTACGGCTTACAGCTCTGCTAACCCTGCTTGTCACCACGCAGCTCGATGCCGGCCAGCACCCAG
CCTATGACGGGCTTGCCTCCCTTCCATTTTTTGATGATTTCGATCTGAGTACCGTCGATGTCCTTCTCATTAGCCAGTAA
GCTTCCCCTACATCCGCCTAGTTTCTTCTGTTACTTGCTCGCCCGACTGCGAAGCTCTTTGAGCTTGGAAAACATGGTGG
TTCCCTATCAGACGAATACCGGGATGTGGCAAACCCGAGTGGCTACCCGTGCAATCTCAGCACGAGCTACAGTAGTGCTG
CTATGGTTTGGTCGCTCTGGCGATGACAGCAGCGTGCCTCCTTGCCCACGTCTCTTGAGGAATCTCTTTGTATACAGTTA
TCAATACAATCAGTTCCTTTCCAACAATTTCTCCGTCTTTGTTGCCCTCCCCCAGAACAGGCGACACTGCGTCCTATGAT
CTCCGTGAATCCACCGATTGTATCTCAACTTTCCAACTGCTTTATACCCCCCTGCTGCTGTCCTTGAGCCAACCTCTCGC
AAAGATACTCGCCCATACTGACTTGCCAATCAAAGTTTCCACGTCGACCACGCTGCCTCCTTGCCCTACGTCCTGGCCAA
GACAAACTTCCGGGGACGTGTTTTTATGACACACCCGACCAAAGCTATCTACAAGTGGCTCATTCAGGACAGCGTTCGTG
TCGGCAACACATCCTCAAATCCGACGTCACAACCGGTCTATACGGAGCAAGACCATCTGAGCACATTCCGCCAGATCGAA
GCCATTGATTACCACACAACCCACACTGTCTCGTCTATCCGCATTACACCATACCCGGCCGGCCATGTGCTTGGGGCTGC
AATGTTTCTCATCGAGATTGCCGGCCTCAAAATCATGTTCACGGGCGACTACTCCCGCGAGCTGGATCGGCATCTGGTGT
CGGCTACGGTGCCCAAGGGTGTCAAGGTCGATGTTCTCATTACCGAGTCTACCTACGGAATTGCTTCTCATGTCCCCCGC
CTAGAGCGCGAACAGGCGCTCATGAAGTCCATTACCGGAATCTTGAACCGAGGTGGCCGTGTATTGATGCCGGTGTTCGC
TCTTGGGCGTGCACAGGAATTGCTGTTGATCTTGGATGAGTATTGGAGCAAGCATTCTGACTTCCAGAACTATCCCATCT
ACTATGCCAGCAATCTGGCCAAGAAATGTATGGTTGTATATCAAACATACACGGGCGCAATGAACGACAACATCAAGAGG
CTCTACGCAGAGCGTGCCAAAGAGGCCGAGGCGACCGGCAACAGCGCTGGCGGTGGCGGTCCCTGGGACTTCCGCTTTAT
TCGGTCGCTCAAGAACTTGGACCGCTTCGAGGATATTGGCGGCTGTGTCATGCTGGCAAGTCCAGGTATGCTGCAGAACG
GCGTCAGTCGCGAGCTTTTGGAACGGTGGGCTCCCAGCGACAAAAATGGCGTCATCATCACCGGTTACAGTGTTGAGGGC
ACCATGGCAAAGCAGATCATGCAGGAACCAGACCACATTCAGGCGGTCATGTCCCGGAGCTTAGCTGGTGGCGGCCGACG
GGCACCGGGAGCGGACTCGGAAAAGGTCATGATTCCTCGCCGGTGTAGCGTGCAAGAGTTCTCTTTTGCCGCCCACGTGG
ACGGGACGGAGAACCGAGAGTTCATCGAGGAGGTCAATGCTCCGGCAGTGGTATGTTGTTTCTGTAGTAGCAAAGAACGT
GCAAATGCTAACGAGGCGCAGATTCTGGTTCATGGAGAGCAGCACAATATGATGCGTCTCAAGTCTAAGCTTCTGTCCTT
GAATGCCGGCAAGGTGGACAAGGACAAGATGAAAGTCTACAGCCCGAGGAATTGCGAAGAGCTTCGTATACCCTTCAAGA
CCGATAAGATTGCCAAGGTCGTGGGAAAGCTGGCTTCAGTGACGCTCCCGACACAACTTCTCCAAGATCAGCAAGAGCAC
CAAACGGCTGGGCCGATATTAACAGGAGTATTGGTGCAGAATGACTTTAAGCTGTCGCTCATGGCGCCTGAGGACCTACA
CGAATATGCTGGTCTGACGACTACGACAATCATCTGCCGGCAGAGGCTGACTCTCAGCGCAGCTGGCATTGACCTGATCC
GATGGGCACTCGAGGGCACATTCGGCACCATCGAAGAGCTGCCAGAGATGCGCCGAAAGCGGCCCTCCAACGGAAAGAGC
AAGAAGAACGATGCTGCCAATGGCACAAGCAACGGCGATGTGCTAACTAAAGAGACACACGGCAACGGGGAGGTCGAGGC
GAAGGACGAAGAAATGTACGATGAGGATGAGGAAGAAGAAGAAGAAGAGGCTGACGAGGAAATCAATAATTTGGTGGCTG
CCTACTTGGTCATGGGCTGCGTCTCGGTGCGGTACTACACCAACGGCGAGATTGAGTTGGAATGGGAAGGCAATCTGCTG
AACGATGGCATTGCCGATGCCGTGATGGCTGTTTTGTTCTCTGTTGAGAGCAGTCCCGCTGCTGTCAAACGTACGTGTTT
CCCTCGTCCCTTCTGCGCACCGCTCACTTTCCTGGTTGCTAACAGTTTAGAATCTGGCAAAAACGGCCATTCCCATCACC
ATCACGAACTACCTCTGCGCAATCTGCACGCAAACATCACCGCAGAGGAGCAGTTTAGCCGTCTGTGCATGTTTCTAGAA
GCCCAGTTCGGTGCCGACAATGTGGCGCCGATTGCCGAGCCCCGACTGCCTGTAGCCAAGGAGGTTGACGACAAGGAGAT
GGTGGACGAAGAGGAAGAAGCACGCAAAAGGCAAGAACAAGTCAGCCGTGAGCTGGATCGCCTACACAAGTCTGGGATTC
CTGTGCCGGGCATTTTGGTCAAAGTGGACAAGATGGATGCCAAGGTCTGGTTAGACGACTTGGAGATTGAGTGCACCCAT
CGGGTGTTTGCCGATCGCGTGAGGGCGGTCGTAGAACGGGCAGTAGAAGTGACAGCTCCTCTTTGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62