GenePrediction:GLEAN_8069 Details

Name: GLEAN_8069
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1257907..1256643 (- strand)
Length: 1265
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1257907..1257847 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_113:1257776..1257739 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_113:1257669..1257628 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_113:1257532..1257107 (- strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_113:1257052..1256798 (- strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_113:1256732..1256643 (- strand)
Length: 90
>GLEAN_8069 class=GenePrediction position=GCSC_113:1257907..1256643 (- strand)
ATGTCTCCTCCAGCTGGTGATGCCCGGAAGGAGTCCAACCTCGCTCGGCTGCTGGGATCTGGTATGAGAGAGCCCGCGTA
TCAGTGGAAAGAAGGGCACGTCCAACAAACATACTGACATACTTGTGGCAGGCTCTGCTGGTATTTCTGAACTGGCTATC
TTCCACCCGGTATGTGGCTCTCGTTTGCGGATTTGGCGGGCACGAAATACTCTGTAGATTTGCTAACTTCGCCCACAGGT
CGATACAATTGCCAAGCGCCTGATGAGCAACGAGTCAAAGGTACTACATCCTCTGCGACAGGACACCGATCAATTTCTTC
TAATCAATTCGTTGCCGCAAGGTGTCGCCAAGCTAATGCATCTGCCGTCTTCCAGATCACATCCTCGGTACAGCTGAACG
CAGTCATCTTCAAGGACAAGGCAACAGCACCTCTGGGACGCAAGTTTGTCTCTCTGTTCCCCGGCCTGGGCTATGCCGCT
GGCTACAAGGTCCTGCAGCGCGTGTACAAGTACGGCGGCCAACCCATCGCCCGCGACTACCTGACCACACACTATGGCAA
GAACTTCGAGGCGGCCTTTGGCAAGAAGACCGGCAAGGCTATCCTGCACTCTACCGCCGGCAGCCTGATTGGCATTGGCG
AGATCGTCCTGCTGCCGCTCGACGTCCTGAAGATCAAGCGTCAGACCAACCCGGAGGCTTTCCGTGGTCGCGGCGTCCTG
CGCATCGTTCGTGACGAGGGCTTCGGCCTCTACCGTGGCTGGGGTTGGACTGCCGCGCGCAATGCGCCTGGCTCGTTTGC
TGTACGTAACCCTACTGGTGCTGTTTTTGGGTCGTCCCCCGTCTAACACAGATAGCTCTTCGGTGGCTCGGCCTTTGCCA
AGGAATTCGTTTTTGGCCTGCAGGACTACAACAAGGCCAGCTGGTACCAGAACTTTGTCGCCTCGATTTGTGGTGCCTCT
GCATCCCTCGTTGTCTCCGCGCCCCTGGACGTGATCAAGACGCGCATCCAGAACCGCAACTTTGAGAACCCCGAGGGCGG
CTTCAAGATCCTGTCCAACATGGCCCGCAACGAAGGCTTCTCCAGTTTCTTCAAGGGCCTGGTGCCGAAGGTGAGCCCCA
CCCTGTCTTGTCGCACCACCCCACCTTCTTGCTTTGATTGTTTCTAACAGCACAGCTTCTCATGACCGGCCCCAAGCTCG
TGTTCTCTTTCTGGCTGGCGCAAACGCTCATCCCGGCTTTTGATAACGTGCTGGCGAAGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62