GenePrediction:GLEAN_8070 Details

Name: GLEAN_8070
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1255862..1248415 (- strand)
Length: 7448
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1255862..1255771 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_113:1255654..1248415 (- strand)
Length: 7240
>GLEAN_8070 class=GenePrediction position=GCSC_113:1255862..1248415 (- strand)
ATGCCTCCAAACGAGCGCGATGCCGCTCTTCCTGACAAGGCGATAAGGCACCAACGCTCTGGCTCTGACTACGGTCGAGC
CCTCATTCCCATGTAAGTCCTGCTCCCAGAGCCAAGAACAATTACCCTTGTTCCTGTCTCCTCTGTCTTTCTCATCGATT
GTCCTTAATGGCAGTTTGGTTACCAACTAACAGGTATACGAAAAAAAGGTGGGACAGCTCCGATCCTGTGCGAGCACCTC
CGCCGCTGCCACTCAATACGCAGTCGCCCAGCGTCGGAGTCGGAACATCGCGTGCCGGGACTTCTGCCGCAATCCAATCT
GCTCATGCGGCACTGCATGAGAAAGCCCGCGAGGCTCTCGGCTCTACCGCTCTGGCCAGGCGCATAGAGTCACCGGAGCG
CCTACCTCGAGCCCCAGTTCCACCCTCTGCCCCAGTCATCACGCCCTCGTCGCAACCACACCGTCGTCTGCCCCCAGTCC
AGCCAGGCTCTGTTCGTGACCTAAGTCTTTTGATTGAGGGTGGTCGTGACTCGAGCAGCCCCACCCCACGCTCTCCCGAG
AAAGCCGTGCGACCGACGACGCCGGTGCGAGGCCGCGATAGTCTCCTGCCAAACGAGATGGATGACCGTCCTATCTATGT
GTCTCCAGTTCCCGGTCCCAGCTACACACCTATCGTACGGCCGATCGTCCGGCGACCACACCAGACCATCCTGGGCGAGA
ACACATCTCCCCAGTCGGCGACAATGCTGGCTCTACACAGTATGGCGTCGACAAATCCGAATCAGAAAGACTCTGGTCCG
TTTTCCAGCGCTCCACCGTCAGCATCGCAGCGCGAAGCACCCGCTCTGTCAAACGTGACAAATGGCGCCGCAGGCGGCAC
CTACGTCAAGAATGCGATGCCGATAGGCAAGGCGCAGCCTGTCCCGGCGCTGGACGCGCTCTCGCAACAAATTCTCAGCC
TGACCAACATTGCTACGTCTTTGCAGAAAGAGATGGGCCTACTCAGTCGCCGAAGCCGAGACAATGCGACCGATCTTCTC
AGTCTCAAGGCGGCCACCAACGCAAGAGACGAGGACATCAGGAAAAGTCTACGTGAGCTCATCACCACGGCAGGAGATTC
CAAGTCTCAATCGACAACCAGAGATCCGTTTAGCGGAGGCTTTCTCATCGATAGCAAGCCCCACGCGCATATGATGTCTC
CGACCCAGAAAGCTCTTCGGCCATTTTCGCTTCCTCGGATCCCTTCGCCAAACAGCTTCGCCGCATCTATCGACCGCGAC
TCTATGAGCACTCCGTCATTATATGGGGCAGATGGACAGGCTACCATTTCCCTCGTCGAAAAAGTTCTCCATGAAATGGG
TACGAAGGAAGGCCAAGAGCTGTTGCTTAGCCGCCTCAGTGAGATCTTGAACAGACTCGACGGCATGGCATCGGCATCAA
AGATCGAAGAGCTGCTGCGTGTAGTGAGAGAGCGTCAGGAACAGACCATCATTTCCATGCCCCGCGGCAGCGATGCCGGT
GATAGCCGCCGCTCGCGGTCGTACAGCTTTGAGGAGCCTTCTGGCTCGGAAATGGAATATGCTAGCAGCGACCATATTAC
GGATCGGATGGAGCGTCTGATGCACCGGAGCGTGCCCGAATTGAGGCGGTCTTCTGCTCCAAATGTACGAATCCCAGATG
GGCTCAATGACGACGTCTTGAAAGTCATCAGGACTGTCAAGGACAGCGTTGCTCAGGGCGGTGGTCTCACAGCTGAAGTC
AAAGCCCTCGTTCGGGAGCTTCGTGGAGAGGTTCTTGGAATGGGTCGTGAGATTGGCCGACGTCTCGACGAAGTCTGGGC
CAAGGAGGAGGACGAACCGGAGTCGAACACGAGAGTCGATATGGCAAAGGTCGTCGAGGAGGGCCTTGCTGAGATGAAGC
AACACATGGGCAACCTTATGCGAGAGCACCGACGCCAATCTGCTGGCACTGTGGCCACTGCCGCTGCCGCTGCAGCCGAA
GCCATTCCTCCCATCGACTACGAGGAGGTTCACAATCTGATTCGTTCCGCGCTGAAGGAGGCGCAGGCCAATCAGGCCGA
TGCTTCCCACGCCAGCAAGGAGGACGTGATTGAGGCGGTCAAGGATGCTTGGGAGTCGTACAAGCCGGATATCGAAGTTC
AACAAATTGGCTTGGAGCGCGAGGAGGTGCTGGCTTGTTTGCGAGAGGGCCTTCGGCAATATTCCCCTCGCGACGAACGG
TCCGCGGGTGTTACGCCCGACGAAGTGTTTGCGGCTGTTGTAGAAGGCCTGAAACACTTTGTTCCCCCCCAGATGCCAGC
GGCAAGCTTGTCCCGAGACGAGGTTCTTGGGGCTGTTCGCGAGTGCCTCGAGGATTACGAGTTTCCTGTCGCTCCATCGG
CAATAGGTGGCGCCGAAATCACCAAGGAGGACATGCTTGATGCCGTTAAGGAAGGGCTGAACGGGTTCGACTTTCCCCAT
GCCGATCGTGACAGCATGGCCCTGGTGGCGCCCACTACCGGCAATGACGAGATTGTCGGACGCCTTCAGGATATTATGAA
GTTTATGCGCGATGAGTTCAAGGCCGTTTCTGACGAGGCGAAAGAGAACGTGGCTGCCAACGGACGTGATACCGAACAAG
TCTTGGATGCTACCAGAGATGGGCTTGAGAAACTCCGTGCCGATCTCGAAGTCTACGTCGACAAAGTCTCTGCTGCTGTG
TCTGGCCAAGACTTCTCCGAGAGTTTGGTTCGGACCCTTGATGTTTTCCGCGACGAGATCGCAGACCTCGTTTCTAAGGC
GAACGACGGGTCCAAAGACATGATCCGGGAGGAAATTGAGTCGCTGAGAGACACCGTGAACTCGTCTCTAGTTCCGGCTG
TCCCTCAGCCGCAACAGCCTTCGGCGGCCATGAGCAACCGTGAAGTTTTGGAAGCACTGCAAGAGGGTGTTGGCCTGCTA
CGGACCGAAATCAATAACCGCCATGTTGCTGGCACGTCAGAGGTGCTTGACGCGCTGCAAGAAGGCATGTCCGATCTTCG
CGACAGCATTGAAAAATTCCGTAACAAGCCCTTGGACCTGACAGCAAATGACGAAATTCTGGAGGCTTTGAAATCCGGTC
TTAGTGACGTTCGCACGGACATCGATGGCTTGCGCGACCAGAGCCGGGATATAGCCACGGTGGAGAGCACTGCCTTGGTT
CCGACTGGAATGCTTCGACCAGACGACATCAAGAATCTCGAGATACTTATTATGCAACTCCGCTCAAAGGTCGACGTCAT
GGGCAACGTATCGGAGCCGACGGCGCGTGCAATGTCTCCCGAATCGATATCTGAATCGTCGCCCGAGTCCACGTCTGAAT
CGTCGCCCGAATCGATATCCGAGGCGACGCCCGAAGTAGCCCGTGGAGGGGCGGTGGCTATGCCACTAGACGATGAGTGG
AAAGAGAAGCTCGCAAAAATGGAGAGCAAACTGCACATGATCCACGAGACAGTATCGGGACTGACAGGCATCCCGAGCCG
GGAGGGCGCACCGGCGCCTGTGGAGGTGCCACGCGCTGCAACAGACGCGGCCAATCGGGAGGATGTTGAGGCTATCGAAA
CGATTCTGCGCAACACGAAGGCACGTCTCGATGACATGATTGACGATGATCAGGTCGTACGCAAGGATCACATCGATGTG
ATTGAGGCTCTCGTGCTGGAAACGAAGCTCAGTCTTGGCGGCTTGAAAACTCAGATGGACGGGCTGTCCTCGCGTGAGGA
TGTCAATATGGTGGAGTCTCTGGTGTCGCAAATCGCCAGAAGCTTCGACGACATGAAGGAGCGTCACGAGCAACAGCTGG
AAAATCCCGACAAAGTCACCAAAGCTGACATCAATGCTATCTCGATGGCCTGTCTAGACGTGAAGTCGGCAGTCGCAAAC
TTTGCAAAGGTCGATGAAATCACAGAGCTGCCGACAAAACACGATCTGGCGAGACTAGAAGCAGTCATTGCAGAACTCAA
GAACCGCCTGGAGACAGAAGCGGAGGTCAGCTCGAAATCTTTCGAAGAGCGACAGGCTGAGATTGTTGGCGTGAGCGAAC
GGGTAAGCGAGGTGAAGGTTTTCCTGGAGGAGTTCCAGGATTCGATCAAATCCAACCTAGAAGGCGGTGTTGTTGGCATC
GAAACTGTCGGCAAGACCTTGGAGACTCTGGGCGAGACCATGGGCCAAAGTGGCAGCGACTTGCATGGCCTGCTAGAGAA
GATGAGAGCAGAGTTCGAAGAGTCGAGAGCCAGCGTCATCGGTGCCAAATTGGAGACAGACGAGAAGTTCCAAAAGACCA
CGGAGACACTTCAGTCGAATATTGACGAGCGCATCGGAGAGATGATGGCCAAGCTCGGCGAAATTCAGGTGTCTGCAGAG
GCCCGGGTCACGGCGGAGGAGGCCCGTGATGTCGAGGTGGAAGCAGCAGTGGTCGGCACGAAAACCTTGGCCGAGGAGCT
CAAACTGCTGGTGGACACGCTCGGGTCTGCTGTCACCGACTCGCTCGAGAAGATGGAGGAGGCATCAAAAACAGTATTCG
ACCGGGTCGGGGTCTTGGTGGACGAGGCAGATGAGCACCATGTTGATGCCAAAGTAGAACACCAGCAGACTCGGGACCAG
GTCAAGGAGGCTATGGACGTTGTCAACGGCTTGCACGGCCATGTGATTGAATACCAGCCCAAGATCCTGGACACGATCAA
GGACGTGTTGACGGTTGTGAGCGAACATTACGAACACTCTAAATCGTCCAGTACCACGATGCAAGAAAAGCTTGTCGATA
CCAGAGGGGTCATTGAGCAACAGCTGGTGCCACCGGCAGTTGAAAAGTACAACGACTCGACGGTGCAGGAAAAACTCGAC
AAGCTCGTTTGCCAGGCAGACCGAGCAGCAGATGCAATCACCAAGCTGGACAAGATGGACGAACTCGTCAGCCACACGCA
CACGGTCGATGAGGCCCTTTCCAAGCTAGACAGACTTGTTGAGCATTCCGAAGACACGGACAAGGCGTTGGAGCAGCTTG
AGAAGCTGGAGACGCTCGACTATCTTGTGGCACAGTCCGAGACGACAACCCAGGCGCTGGCTGACCTTGAAAAACTCGTC
AAGCTGGATCAAATCATTGATCTGACCAGCCTGGCCGGGCGGGCGTTCGACAACCAGCGATCTAAGATTGACCGGCTTAT
CGACCACACGCAGGTTACGAACGAAGCGTTGAAGGGACTGGAGAAGCTTGAAGAGCTCAAAAAGCTGAGCAATCTGGAGC
AGCTTGAGAAGCTAGCCCAGCTTGAGAAGCTAGAGCAGCTTGAAAAGCTTGGACAGCTAGAGGGTCTTCAAGAGCTTCGA
AACCTGGAACAGTTGACGAAGATGGAACAGCTGGACAAGTTGGAGCAACTGGACAAACTAGAGGGACTGGAAAAGCTGGA
CCAACTGTTTGACCTAAATCAACTGGAGAAGTTGAAGGAACTAGAAAACCTGCAACTGCTGGAGAAGCTCGGAGAGCTGG
AGAAGCTTGGAGGACTAGAGAAGCTTGGCGACCTTGAGAAGCTGGCTGATCTGGAGAAGCTTGGAGGGCTTGAAAAGCTT
GAGCTGTTGGAGAAGCTAGATGGGCTAGACAAGCTTCAACAGTTGGTCGAGCTGGAGCAGCTTGGAAAGCTGGAACAACT
CGACAAGCTGGAGCAACTCGACAAGATTGAGCAGCTAGAAAAGCTTAGTCAACTGGAGAGCCTCGGCGAGCTCGGCAAGC
TCCAGCAACTCGACAAGCTGGATCAACTGGAAAAGCTTGAGGACCTGCAGAAGCTCGAGCAACTGCAGACGCTTGGACAA
CTGGAGAAGCTCGAACAGTTAGAGAAGCTTGGCCAACTCGAGTCTCTTGGAGAACTAGAGAAGCTGCAACAGCTGGACAA
GTTAGAGCAACTAGACAAGCTCGAACGGCTAGAGAAGCTCGAGAAGCTCGAGCAACTGGAGAGTCTTGGCCGGCTAGATA
ACCTCGGACAGCTGGACAAACTGGGAGAACTCGAAAAGCTTGAGCAGCTGGGCAAGCTGGATCAGCTGGAACGTATGGGG
CAACTCGACAAGCTGGAGAAACTGGACAAACTGGACGAGCTGGAGAAGTTGGACCAATTGGAAAAGCTGCAAGAGCTGGA
GCAGCTGGGACAGCTTGAAAAGCTAAGCCAGCTTGACCGGCTAGACAAGCTGTCAAAGCTGGACCAGTTCGACGAGCTTG
TGGACAACTCGAGGTCAGCGGACAGAGCACTGTCCCGTCTGGACACTCTGGAGCTGGTGCACGACCAGATGAGACGGACA
GCGGCCGAGATTTCGGTTTTCCTCTCGGCGCAGACGCAGAGGATTGCGGACGAGCACGAGGGCCAAGAAAAGACGCTGCA
AGAGACGAGTATAGCGCTGGAGCGACGACGGGCGGAGGCGGAGCAGGCGGAGAAGAACATCGCATATCTGCAGGAGGAAG
AGAGGCTGCTGAAGGAGAGCGTGCTGAGCCTGCGGACAGAGCAAGAGAGCTTGCTTCGCAACCGGACACGGATGACGGCA
GATGTGTCATCGCTGGAGACGGCGTTGCGCATCCGGCGAGAGGAGCTGCACGAGATGGAAGGACGAGCAGAAGGTCTGGA
GCGGCGGATTTTGGAGGGAGTGATGGACCACTCGCGGGTGCTTTTGATGGCAAAGGGGAACAAGGGCCGCGAGGCTATGA
ACCGAAAGAGGGTGGTGCCGTCGAAGGAGGCGAGTTCGCCAGGCCGGGCTTCAGACATCAACAGCGGCAACAAAGCGCGG
TCGGCATTCAGCATCGCAATGTCTCAGCGGAATCCACTGCCAGCAACGTCTGCCAACGGGACGGGCAAGGCGGGCTCGCG
CAGAATCCTGTCGCTCAGCCAGATCAACAAAACCGGGGCGAGCGGGGGGATGAAGCGGAGTCAAAGCGTGCGGACAGCCG
GAGACGGACTGCGAAAGAGTAGCTGGGCCGGACGACAGGCGACGAAGACGTACGGGGGACTGGACACAGACAAGGAGAAC
ACGCCGCTCCATGAGACGGACGAGGAGGATGGGGTACACGAGGAGGAGATGGGCGACGAGGAGATGGACGACGAGCGGTT
GCACGACGACAGTGGGATGAGCTTTGAGGCAGAGGCAAGGATGGAAGAGGTGTATGGGACAGGAGGAGAGTCCGATGGCG
AGAAGATTGATGGCGAGAAGGATGCCGACAAGGATGCCGACAAGGACGGAGAGAAGGACGCCGACAAGCACAGCGAAGCG
GGAACGCTGCGGCGGTCGAGCTACGCGACATCAGTAGGAACAAGAGCAGTGACTAGTGATGACGACTCGGATTACTCTGA
CAGGGACGAAGACGAGGTGATGAGCGAATGGACCGACAGCCAGGCGGGCGCGAATTCGGCAGGGCCGAGTCCGGTTGAGG
GTGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62