GenePrediction:GLEAN_8073 Details

Name: GLEAN_8073
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1235296..1233202 (- strand)
Length: 2095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1235296..1235216 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_113:1235129..1234457 (- strand)
Length: 673
Type: CDS
Source: GLEAN
Position: GCSC_113:1234403..1233202 (- strand)
Length: 1202
>GLEAN_8073 class=GenePrediction position=GCSC_113:1235296..1233202 (- strand)
ATGTCTATGGGACCCGCCGTCGGTATTGACTTGGGTACCACGTACTCTTGCGTGGGTATCTTCCGGGATGACCGGATTGA
GGTATGTACCTGACGGGAGCTCAGCTCCTAAGATCTTTAAACATCTGCATCTGGGTTCATCATTATACTAACAACTTTCT
TCCACAGATTATTGCAAATGACCAGGGTAACCGCACCACACCGTCCTTCGTGGCCTTCACGGACACGGAGCGGTTGATCG
GTGATGCCGCCAAGAACCAGGTCGCCATGAACCCCCAGAACACTGTGTTTGACGCCAAGCGGCTCATCGGCCGTCGGTTC
GCCGACGCCGAGGTCCAGGCCGACATGAAGCACTTCCCCTTCACTATCGTTGATAAGGGCGGCAAGCCCATCATCGAGGT
CGAGTTCAAGGGCGAGAAGAAGCAGTTCACCCCCGAGGAGATCTCCTCCATGGTCCTGACCAAGATGCGTGAGACTGCCG
AGTCTTACCTTGGTGGCACAGTTAACAACGCTGTTATCACCGTGCCCGCATACTTCAACGACTCCCAGCGTCAGGCTACG
AAGGACGCCGGTCTCATTGCCGGCCTCAACGTCCTCCGTATCATCAACGAGCCTACTGCCGCTGCCATCGCCTACGGTCT
TGACAAGAAGGTTGAGGGCGAGCGCAACGTCCTGATCTTCGATCTGGGCGGTGGTACTTTCGATGTGTCTCTGCTCACCA
TTGAGGAGGGTATCTTCGAGGTGAAGTCCACTGCTGGTGACACTCATCTGGGTGGTGAGGATTTCGACAACCGGCTGGTC
AACCACTTCGTCAACGAGTTCAAGCGCAAGCACCGCAAGGGTCAGTACTCCTGTCTCAACTCTCACTAACAATTATATAC
TAACATTTCTTAGACCTGTCTTCAAACGCACGTGCTCTGCGTCGTCTGCGCACGGCTTGCGAGCGTGCCAAGCGTACTCT
CTCTTCGTCTGCCCAGACCTCTATTGAGATCGACTCTCTCTTCGAGGGCATCGACTTCTACACCTCCATCACCCGTGCCC
GCTTTGAGGAGCTTTGCCAGGACCTCTTCCGGTCGACTCTGCAGCCTGTTGACCGTGTCCTGACGGATGCTAAGATCGAC
AAGTCCCAGGTTCATGAGATCGTCCTGGTCGGTGGTTCTACTCGTATCCCCCGCATCCAGAAGCTCATCACGGACTACTT
CAACGGCAAGGAGCCCAACAAGTCCATCAACCCCGATGAGGCTGTTGCCTACGGTGCTGCTGTCCAGGCCGCCATTCTCA
GCGGTGACACCTCGTCCAAGTCGACCAACGAGATTCTTCTGCTCGATGTTGCCCCACTGTCTCTCGGTATCGAGACTGCT
GGTGGCATGATGACCAAGCTCATTCCCCGCAACACCACCATCCCGACCAAGAAGTCCGAGGTGTTCTCCACCTTCTCCGA
CAACCAGCCTGGTGTGCTTATCCAGGTGTACGAGGGTGAGCGCCAGCGCACTAAGGACAACAGTCTGCTGGGCAAGTTCG
AGCTCACTGGTATCCCGCCCGCACCGCGCGGTGTGCCCCAGATTGAGGTCACCTTCGACCTGGATGCCAACGGTATCATG
AACGTGTCTGCCGTCGAGAAGGGCACGGGCAAGTCGAACAAGATTGTCATCAACAACGACAAGGGCCGTCTTTCCAAGGA
GGACATTGAGCGCATGCTTGCGGAGGCCGAGAAGTTCAAGGAGGAGGATGAGGCCGAGGGCCGCCGTGTCGCTGCCAAGA
ACGGCCTCGAGTCGTACGCTTACTCCCTGCGCAACACTCTCAGCGACTCCAAGGTCGACGAGAAGCTTGACGCTGCCGAC
AAGGAGAAGCTCAAGGCCGAGATTGACAAGATCGTTGCTTGGCTCGACGAGAGCCAGCAGGCCACTCGTGAGGAGTACGA
GGAGCACCAGAAGGAGCTCGAGGCTGTTGCCAACCCGATCATGATGAAGTTCTACGGTGCTGGTGGTGAGGGTGGCATGC
CGGGTGCCGGCGGTCCGGGTGGCTTCCCTGGTGCCGGTGCTCCTGGCGCCGGTGCCGCGCACGATGACGGCCCGACCGTG
GAGGAGGTCGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62