GenePrediction:GLEAN_8074 Details

Name: GLEAN_8074
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1231532..1228650 (- strand)
Length: 2883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1231532..1228650 (- strand)
Length: 2883
>GLEAN_8074 class=GenePrediction position=GCSC_113:1231532..1228650 (- strand)
ATGAATGCGGTTCGCTGCTCTCGTTCGGCCGTGTCTCTGCCGGCATGGCGGGCGTCCCAGCTGAGCCGTTTGCCACGGCA
CCGAACGCCTCGATTTGCGCAGACAGGCAACGTCTTCCGCCGGTGGGAGACGTCGACGACGGGCGATGACAAGAGCGGCC
ACATTGCGGCGCAACCCGGCGAGGGCATCATCTTCTTCGACAATGTGTTTCCGCTGCGCGTGAGTAGTGTGGTGAATTGG
CGGCTGTGGTTGTCTGCGTCGGACTACACCGACGCGGATGTGTCTACGCTGCTAAGGCGGCTCACCGGGGCCAAGTCGAC
GTCGTCTGGGCCATCTCTACTATCGCCCATCCTGTCCATGTTCGACCCCGTCGCGCAGGTGCAGCGGGCCATCCCAGCCG
ACCTGCCGTTGACTATCACAGAGATTGTGCCTCGACTGAAAGACGGCGGCGTGTTTATCAAGTTTCGACACCCGGCCGAC
CTGGCGGCGACCGAAATTGAGGAGTCCCTGACGAGGTCGCTGTACAAGAGCCCAGTACGGCCCTGGTTCAATCCGCTCTG
GGGCTGCATGCGTGCAGGACTCGTGCGCGGCGTGCCCTGGCTAGAGGATCTGGCCTCGCGCGTGCCATCAGAGCGGGTAC
GTGTTGAATTTTGTGCGCCACCACCACCACCACTACTGCCAAGCAGAACAGGAGCAGCAAGTTCCGCGGCTACGACTGCT
CCGGTCGCTGGCGGTGATGCGTCGGGCAGCGCCAGCCTGGAGCTCTCGCAAGAGACCATCTACAGCCTGTTCCGGCGCTA
CGGAAAGATTGCGGAGATCTCGTCGCAGCCGTTTGAGTCGAAGACGCTGCCGCGGTATACGGTGATTGATTTTGTGCGGG
TGCGTGACGCCGTTCTGGCGCGCAGCTGTCTGCACGGATATGTGGTCAACGGGGCGACACGGCTGCGGCTCTCGTACGAG
CCGCGGGCACGGGCACACCACATTTGGGACTGGCTGACGAGCCATCAGCGAATTGTGGTTCCGATCTTGGCGGCACTGCT
GGCAACGGTCACGGTGGCAGTATTCGACCCGATCCGGACGTTTTTCATCCGAGCGCACGTGCAGCACTCGTTTGCGTTGC
GTGACAGCAGTCTGTACAAATGGCTGCAGCGGCGGACATCGGCGATGCTGGCGTTTGCGCGTGACTCATACGACGCAGCG
GCCGACGGGATGGGAATGGGCAGCGGCGGCAGTGGTGTGGGCAGCGGCAGCCGGCCTGGGCTGCGGGCGTTGCTGAGCCA
CCGGCGCGATCTGCTCGACTGGCTGAACACGTGGCTGCTGGAGACGTCGGAGACGTTCATCGTGGTGCAGGGACCCCGGG
GCTCGGGCAAGCGCGAGCTGGTGGTGGACCAGGCACTCAGCGGGCGGCGGGACGTGCTGGTGATCGACTGCAAGCCGATC
GTGGAGGCGCGGGGTGAGAGCGCGACGATCAAGAAGATGGCCAACGCGGTCGGATACCGGCCGGTGTTCTCGTGGGCCAA
CAACATTAGCAGCCTGGTCGACTTGGCGGTTCAGGGCACGACGGGCGTCAAGTCGGGCTTCTCCGAGACGTTGGACGAGC
AGCTGGCCAAGATCCTGCAGACGGCGGCGGTAGCGATGCGACAGGTCGGCCTTGCCGGCCGCCACAAGAGCGACATTGAC
GCCAGCCTGAACGAGGACGCGTACCTGGAGGCACACCCAGAGCGGCGACCGGTGATTGTGTTGGACAACTTTGGCCAGCG
CAACGAGGACGCCACCGGCCTGGTGTACGACAAGCTGGCTGAGTGGGCGGCGGCACTGGTGCAGGCAAATGTGGCACACG
TTGTGTTCCTGACGAGCGACACGTCGTACCCCAAGGCGCTGGTCAAGGCGCTTCCAGACCGCGTATTCCGGCAGATGGCT
CTAGGAGATCTGTCGCCTGCGGTGGCCAAGAAATATGTGTTGAGCCACCTGGCGGTGAAGGAGGACGACGGAGAGAACAG
CAGCAGCAGCAGTGAAGAGAGGAAAACGGCCATCGAGGCTGTTCAAGAGGAAAGCGTGGCAGTGACGACAACGACGACAA
CAAAGACAGATAGCCCCCTGGGCGCGACGCAGACTCGGCGGGAAGCGATCAGCGAGCTGGACGAGTGCATTGGCGTGTTG
GGAGGTCGTCTGACGGACCTGGAGTCGCTGGTGCGACGGCTGAAGAGCGGGCAGAGGCCGAAACGGGCGGTGACAGAGAT
TGTGGACCAGAGCGCCACAGAGATCATCAAGATGTTTCTGCTGGCACCGAGTAAGCAGGCTGGCGGCAGTAGCAGTGGCA
GCAGTAGCAGCTCATCGTCGAGCGGCTCAGGAGCGGCTCCGGGTGGTGTTGGCTCGACGGCGGGCAGCAGAGGAACGAGC
TCGCCGCGAGCGTGGACGGCTGAGCAGGCATGGTACCTGGTTCGAGAGGTAGCGGCTAAGGAGAGCCTGCGGTACAACGA
AGTGCTGCTGTCGGACTTGTTTGCGACGGCAGACGGGATGGACGCGTTGGACGCGCTGGCAGCAGCCGAGCTGGTGACGA
TCCGGTCAGCACGCGGACGGCCGCAGACGATTCGCGCCGGCAGTCCCGTGTACCAGGCAGCATTTTCACGGCTGCGCAGC
GACACAGCATTGGCGGCGCGGCTGGACCGCAGCGTGCTGGCGGCTCGGACGGCCGTCGAGACCAAGGCGGTGGCCAAGGC
CGAGGAGGAGCTGGTGCTATTGGGCAGCCTGCCACGACAGCCGGCACAGACGACTGAGCGGGTGCAGTACCTTTTGATGA
AGCTGCAGACGGCCCAGGCTCGCGTGACGGCGTACGATACGGAGATGAGCCGGCTCAAAAAGGTCATGTCGGAGGAGGTG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62