GenePrediction:GLEAN_8076 Details

Name: GLEAN_8076
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1209212..1207379 (- strand)
Length: 1834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1209212..1209003 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_113:1208908..1207379 (- strand)
Length: 1530
>GLEAN_8076 class=GenePrediction position=GCSC_113:1209212..1207379 (- strand)
ATGCCTCCTCACGTGGCCGTCGACGGCCCTCAACCGGCCAGCTGGAAAGAAGCGTCCGTCTACCAGATCTACCCAGCATC
GTTCAAGGACTCGACCGGTTCCGGCACTGGTGACCTACAGGGGATTATCTCCAAGGTCGACTACCTGCATTCACTCGGGG
TCGATACTGTCTGGCTGTCGCCGATATGCGAGAGTCCGCAGGTGGACATGGTGAGATTGTTTGCCCAATCGCGTCTCCTT
TTCCTCTTCGACCATTCTATTCCGTCTTTCTGTCCCCGTGTTTCTCAGTCTAACCACTATTCAGGGCTATGACATCAGTA
ATTACCGCGTCATCGACCCACAGTATGGCTCCCTCGACGATATGGACGAGCTCAAGGATCGGCTACACGAGCGCGGAATG
AAATTGGTGTTTGACCTGGTGGTGAACCACACGAGCGACCAACACGAATGGTTCCGGCAGTCGCGCAGCTCGGTCGACAG
TCCGTATCGCGACTGGTACATCTGGCGGAAACCGCGGATCGATGCGGACGGCCGGCAACAGCCGCCAAACAACTGGCAGA
GCCACTTCCAGGGCAGCGCGTGGGAATACGACGAGGCCTCGGGCGAGTACTACCTGCACCTCTTCTGCCGCGAGCAGCCG
GACCTGAACTGGGAGAATCCGACGGTGCGGGCGGCAGTGCACGAGACGATGCGGTTCTGGCTGGACCGCGGCATCGACGG
CTTCCGGCTGGACGTGATCAACTTCATCAGCAAGGACCAGGCGTTTCCGGACTCGGACCGCAAGGTGCTGGCAGGCTGCG
AGTTTTATGCAGCCGGGCCGCGGCTGCACGAGTATCTGCAGCAGATGGGCGCGATCCTGCGGGAGTACGGGGCCTTTAGC
GTGGGCGAGATGCCGTGCGTGGGTGACACGGACGAGATCATCAAGAGCGTCGGGGCCGACCGCGGCGAGCTCAACATGAT
CTTCCACTTTGAGCTGATGGACCTGGACCACGGGCCGGCCGGCAAGTTCTCGCCGCGGACGTGGGCCCTGGCCGAGCTCA
AGGCCATCGTGGCCAAGTGGCAACGGTTCATGTACGACCACGGCGGCTGGAACGCGCTTTATCTGGAGAACCACGACCAG
CCGCGGAGCGTGAGCCGGTTTGCCAGCGAGGACCCGGCCTTCCGTGCAGCCAGCGCCAAGATGCTGGCCGTCTTCCTCGG
CTTCCAGGCCGGCACGCCCTTCCTCTACCAGGGCCAGGAGCTGGGCATGCACAACATCCCGGCCACCTGGGACATGGACG
AGCACAAGGACGTCGACTGTCTGAACCACTGGGCGCTGCTGCAGGGCGACGGCGGCGATGATGAAGCGCGAGCGGCCGCG
CGGCGAGAGTACACTAAGAAGTCGCGCGACAACGCCCGCACGCCGATGCAGTGGGACACCACGGCGCACGCTGGCTTCAC
AGCGCACGAGGCGACGCCCTGGATGCGCGTGCACCCCAACGCGGCCGTGGTCAACGCGGCAGCCGAGCAGGCCGACCCGG
ACTCGGTCTTCCACTGCTGGCGCCGAGTGCTGGCAGCACGCAAGCAGCACAAGGACGTGGTCGTGTACGGCAGCTTCGCG
CTGGTCGACGAGGCTGATGAAGCCGTCTTTGCGTATTCCCGCACGTCGGCCGCCGGCAGCGTCGTGTTCGTGGCCTGCAA
CTTTACCGCCAAGACGGTCCGGTGGAGAAAGCCGTGGACCGGGGCACCAGAAGTGCTGCTCTCCACCGTCGGACGGTCGT
CAGACAGCCTTGAGGGCGGAGATAGCATAGAGCTGAGTGCGTTTGAGGGTCTGGCCGTGCTGTTGCAGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62