GenePrediction:GLEAN_8077 Details

Name: GLEAN_8077
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1202442..1201164 (- strand)
Length: 1279
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1202442..1202238 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_113:1202185..1202091 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_113:1202033..1201797 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_113:1201730..1201526 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_113:1201471..1201164 (- strand)
Length: 308
>GLEAN_8077 class=GenePrediction position=GCSC_113:1202442..1201164 (- strand)
ATGCCGTCATTAGATTCGTTCCCACAAAAGGTGGACCAGAGCATTGCAAGGACTCGCTGCCTTAAGCCTCTGGTCTATTC
CGGTTCTCTAGATCACTTCAGCCATAATGACCTGACGCCTTGTATCGGACGGGAGTTCAACGACCTCCAGGCCGTGGACC
TACTAGACGCCGACGAGCAGGTGTTCACAGACTTGGCAGCTACCAGTATGATCCTCCTCCATGCTGTCGTTTGGGAGCCG
CTTCTAATTGTTGCTAGTTTCGGAGCGTGGTGTTGTCTTCCTACGTGACCAGCAACTCACACCGGAGCAGATGAAACAAT
TTTGTCTGCGGATAACCCGAGCTGCTGGATGCGTGAGTCTCTGCTTCGACTCCCAGTTTTCCAGCCCGTATATCTAACAA
AAAAAATAGCCAGAATCTTCTGGCCTGCACATCCACCCTCTCACGGAGCCGAGCAGCGAGCTGGGCGACCAGATCAGCGT
CATCAGCAGTGAGAAGCAGAAGAAGGGCGGCGGCCTCACGCACCAGCTCAACGACGTCAGCCGGTTTGCCAGTACCGGCT
GGCACTCAGACATCTCGTTCGAGACCGTCCCGTCGGACTATGCCATGCTAAAGATCCACACCTTGCCACCCACCGGAGGT
GATACAGTAAGTCTTTACGGCACCATGTGGATTTATTGAATAGATATCCAGATGCTAACGTAGCTACATTAGCTCTGGGC
TTCTGGATATGAGATTTATGACCGTCTGTCCCCCAACATGCAAGACTTCCTTGAGGGGCTCACGGCGACGCATGACGCCA
TGTTCTTCCACGAAGAAGCCGAGCGTCTCGGCAATCCCATCCGCAAGGACATCAGGGGCTCCCCACTTAATCAGGGTGGA
AACCTCAAGGCGACACACCCTGTGATTCGGACAAACCGTATGGCTTCCTACCCGTGGTATTTTCCTGTGGTCATGGTCTA
ATACTTCCTAGCTGTCACCGGGTGGAAATCTGTCTATGTGAACAAGGGCTTCACGAAGCGCATCAATGGCGTGACGAAAG
ACGAGTCAGATATGCTGCTCAGCTATTTGCTTAACTTGGTGACCCAGAACCACGACGCCCAGGTCCGCTTCCGTTGGCGC
AAGAACGACATGGCGATCTGGGACAACCGCAGCACATGGCATTGCGCCACATACGATTATGCCGATGCCCGGGCCGGTGA
CCGGGTGTGCTCGCTGGGTGAGGTACCCTATCTAGATCGGGACAACAGCAAGAGCCGGAGGGAGGACTTAAGCACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62