GenePrediction:GLEAN_8078 Details

Name: GLEAN_8078
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1193402..1192277 (- strand)
Length: 1126
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1193402..1192990 (- strand)
Length: 413
Type: CDS
Source: GLEAN
Position: GCSC_113:1192935..1192822 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:1192751..1192277 (- strand)
Length: 475
>GLEAN_8078 class=GenePrediction position=GCSC_113:1193402..1192277 (- strand)
ATGGCGCTATTCAACGTCTTCCTATCTCTCGCCGTCTTGATGGCACAGCTGCTTCTAGCTGCTGCCCAGGATCGGCCCAA
TACTACTACACCCTGTGACTTCTACACCAACAAAACTGTGGGCGAGAACACGGCTGACAACGAGCGTATCCTGATGGCCC
TCGTCCTGCACTCGGCCCTGCTGGGTCCCTTCTCCAAGTACAACACCATTTCCGTCGCTGGCTTCACCGGTGCTCTCACA
CCCACCACCTATGCAGGTGAGGACGTCGACCTCAACGGCTACTTTGACGGCGCCTTTGCCTCCGCCAATACAGGCGGATC
CTCGGGTGCCGCCGTTAACTTCCTCGACGATGGTGGCCTCGAGGCTGCCCGCAACCTGAAGCCCGGAAACGGCAACACCA
CATCTGCGCAGTAGTAAGCCATCTCAGAGTCCAAATCACGCACAGCTGCTGACCAGACGGCCTATAGCATATTTTTCACA
CACGTGTACTCCTACTTCGCCGCCTTCCTTGGCTGCTCGCACATTGGCTCCGCAACGTTGCCCAACTATGCCGGCAAGGC
ATCCATGTACGAAGTGCACAAGTACGTTCACCTTTCTTGTCCCTTCTTCTTCCGTCCCCCCTCCTTGCCTTCGACAGTCT
GACAGACACAGGTTCATGGACCTCAATGCCGGCGAAATGGGCTTCTTCGTCGACCAGGCTGTTCGCGGCCTGCTCTCCAT
CGGCTTCAGCGATCCCGATGCCCAGTTCGTCAACAGCACTCTCACCGACAAGTTCAACCTGCGCTGCGCCCCGGCAGAGG
CAATTATTCCACCTAGCGCTGGCGCCCAACTGCAGGCCATCTGCATCGCTCCCGACTGCCTGCTGTCGCCCAACGACACC
TGCTTGGCCTACGACACCGCTGTAGCCCCAACCGTCGCTAACGCTACTCTTCTCGGCAATTATACCAAGGACGCCAACGG
CACCACCGTTTTCAACGCCTCCGAGACCAGCACCAGCACCTCTTTGCCGTCCTCCACTGTCGTCAGCGCCGCCTCCAGCC
TCTGGCGCAAGACCACCGCCTCTGACCTGCTTGGCCAGGGCTTGGCCATCATCGCTTCACTCGTGCTGGCTACTCTGCTG
GCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62