GenePrediction:GLEAN_8079 Details

Name: GLEAN_8079
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1188201..1186483 (- strand)
Length: 1719
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1188201..1188004 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_113:1187913..1187763 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:1187697..1187613 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:1187552..1187430 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_113:1187374..1187130 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_113:1186955..1186483 (- strand)
Length: 473
>GLEAN_8079 class=GenePrediction position=GCSC_113:1188201..1186483 (- strand)
ATGGCCGACGGCGAGACGATGACCGGCAATGCCTCTACGGAAGCGGATGACCATGGATTCGAGTACGCGGGAAAGCCTTC
GCACCTTGTCGTCAAACCGACACCTGGGACAGACGAGGAAGCTCTTAGGAGCCCCATCGGGCACAAGCCGATCCCCTTCA
GCCGCCAGCACAGCAAGATAGACCTCGACGACTACTTTGTGCGTAATTTCCGGCTCCATTCTACCCGCCAGCAAGCAACA
TCCAAGTCTGCCGATAATCGCCACGTGAACTAACACTACCTGCGACAGTCTGGTCCTCGAGATGTTCTGAGGCACTCCAA
GTGGCCCCTGTTCCTTCAAATGCATGGTAGCATCCTACCCAAATTGATCGTCCCTCTGCTTTGGCTCGGCGGGTGGGCCA
CGTGCATCACTTGTATTTCCTTCATGACGAACGTGAGCTGTAAGTTCGGCGCGATCCAGACGCTCTCTCAATCCGTCACT
CAAACTGACACTGTTCTGCAATAGTGGGAATCAATTCTACGCTTCTGACCGTCACCGGTTTTGTCGTCGGTCTGGCCTTG
AGCTTCCGAAGCTCCACGGCCTACGAAAGGTGTGCATGATACGGCGCAGGCAACACGTCACCATATCATCGCTTACTAAT
ACTTGACAGATACAACGAAGGTCGGAAGTCATGGGGCCAGCTGGTCTTGACGTGCAATGTTCTGGGTCGTGTTTATTGGT
TGCACTGCTTAGAGCGAGAAGAACACAAGGAAAAAGACGTTCTTGCCAAGCTGTAAGCTTACCAGAAGATAGTCCGCTGT
ATTATCTGCAGAGACTGACAAGTACAGAACCGCCATCAACCTCTTAAATGCCTTCGCCGTTGCTCTCAAGCACAAGCTAA
GACACGAGCCCTACACAAACTACGAGGACCTTGTCAACCTTGTTCCCCACATCGACACGCTCGCCGGCGACGCGACTCGG
GCGGATCCCAACAGCGCCAAGGGATTCAAGAAAGGCGTCTTCAAGACGGTCGGCTCTCTTCTGGACCTCTCTTTCGCGGC
CAGCAACCCGAGGAAAGCGATAAAGAAAGCGCGTCGACCATTGGGAAACCTGCCTCTGGAAATTCTGTCGTACCTGGCTT
CTTTCGACAAGACGAAGTTATCAAGAACGGACAGCTACCTTACCCTCTGCAACAGACTCTAGCGTGTAAGTTCTTGGTCG
TCTAATTTATACCTGGAAGCACGGTACTAATGGGCTGAATGTGCAGACACCAATATCACCTCCCTAAACGATGTCCTGGT
GCAGACAGAGCGCGTGCTTACCACACCTGTCCCGGTCGCCTATGCCATTGCTATCAACCAAATTACCTGGATATATGTCA
CGCTCCTGCCTTTTCAGCTGTTCAATTACCTAGGGTGGGTGGCTATCCCGGGAACTATGGTGGCCGGCTACATCATCCTC
GGCCTTCTTTACATTGGGTCCGAGATCGAGAATCCGTTTGGCAATGATGTGAACGACCTGCCATTGGAGTTCTACTGCAC
ACAAATCGCACAGGAGCTGGACGTTATCACGTCGAAGCCGAAACCGGCCAATGCCGACTGGATTGAGACTATCGATAACA
AGGTTCTCTGGCCGCTGAGCTCCAGCGGATATAACGTGTGGGCCAACCGGGGCGAGAGCAAATTGCGCGACGCACTGAAA
GCTAAGTGTGAGATGGCTTTTGAGGACGAAAAGCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62