GenePrediction:GLEAN_8080 Details

Name: GLEAN_8080
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1180797..1179441 (- strand)
Length: 1357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1180797..1180416 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_113:1180349..1180228 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_113:1180016..1179441 (- strand)
Length: 576
>GLEAN_8080 class=GenePrediction position=GCSC_113:1180797..1179441 (- strand)
ATGGCGTCCTCTTTTATCCACCAAGCCCTGGACCAGTTCTTGGAACAAAACCCGCCAAGAGAGTACATCAACGCCCTCAA
GTCATTTCTCGATACTCCCTTTCCTACCATGCGCAGCGCCACGTGGATCCCATCTGCAGATGAGGTGGCGATTCGCCAGG
ACCTTGCAAATGAGCTTCTTAAGAACATCCAGGCAACTTACCCGATGCTTACTGCCTTTACCGCCGTGCAGGTCTCTATT
CTTTTGCTTATGCCACTTGATCTGCTTCGTGATCTTGTGCGCAACACTAAACTCGGTCCTGATGCCAACGTTGGTCACGT
TCTTAACGCTATCGCAGGCTTCCATTGGGTGCGTGAGAGCATGCGAGACCTTATCAGATACTGTGAGTCCTTCCTTTTTG
AAGCTATTTTTTATTCCCTGCCTATGCTAACTAACGGATACCTTATAGTTCTACAAGGAAAACACCCGGATGCAGCTACG
AAAAAGCGAAAGGCTCCTAATAAGGAGCGGCATGCAGTTGAGGGGCCACCCGAGTCTTCTACACATCGCAACGAGGCGGA
AAAACAAATGGTATTGTCCGCTAGATCCGCATGTACATCTTTCGCTGTCCTAACTTTGCTAGTGTCTTGAGAGGGATAAT
CGCATGTGCGTTCTAACACACACTATACACCCAGAGGCGTGTCACATTGTGCCATTTGCGTTTAATTCTTGCACGACGAA
CATAATCCTGTATACGTCGCGGTTTCAAACTTGTTTGCAAATGTTTTTTCCTCCCCCCGAGGTCATTTCATACGTCTCCC
TCATCGAGGCCAGCTTAGGCACCTCTGATAAAGCATGGAACATGATTTCGTTGAACCCATATTTGCACGCGTGGTGGGCA
AAGCCACACTGGGGAATCGAGTGCTCCGGGATTGTGCCGCGGGGGGAGAAGCATGCCGTTGTGATACTATTTCATTGGAT
GCCGCACAAAAAGGGGGACCCACGGCGGACGATCCGGGTCGAGCCAGGAACAAATGACTGCCAGAGGATGGCAGACGCAC
TAGCGGAAGGGTCATACGGGGAGGGCCGCGGGCCTGACCTGAAAGGCTATGCCAACGCCATCCAGCACAGTTCGTTTAGA
CCTATTGTCACTGGCCAAGAGTTCGAGATCGCTCTCGACACGCTTGAGGAGGCCAATAATATGCGCAAGATGATTAACAT
CCAATGGGCTTGTGTGCGAGTGGCAGCCATGTCTGGTTCTGCCGGCCCAGACGACTTGGACGAAGACTTTTCAGAGTTTG
ATTTCGAACGGGAGGCTTTCGAGAGGGAGATGATGCTAAAGGGGTCCGACGACGACGACTATTCCACTGACAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62