GenePrediction:GLEAN_8081 Details

Name: GLEAN_8081
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1174837..1169969 (- strand)
Length: 4869
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1174837..1174444 (- strand)
Length: 394
Type: CDS
Source: GLEAN
Position: GCSC_113:1174374..1173989 (- strand)
Length: 386
Type: CDS
Source: GLEAN
Position: GCSC_113:1173873..1173174 (- strand)
Length: 700
Type: CDS
Source: GLEAN
Position: GCSC_113:1173108..1173056 (- strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_113:1172968..1171790 (- strand)
Length: 1179
Type: CDS
Source: GLEAN
Position: GCSC_113:1171705..1169969 (- strand)
Length: 1737
>GLEAN_8081 class=GenePrediction position=GCSC_113:1174837..1169969 (- strand)
ATGGTTCAGAAAGCCACAATGCAAGACGTGCAGAATTCCGGAGACAATTCCGCAGCTGGTGGTGGCAGCAGCCAGACGGC
TCGCCTCATCCTGGACATTATTAGTGAATATGCACTCAACAAGTTTGATAACGCAAAGGAGCAGCAGCAGGGAGGTGCAG
CCCATTTTCTGGCAATCATTGGCTGGTCTATCGAGGCTGGCACCCCGGTTGAGACATGTCTTCCGGCCTTTCCGTTCAAG
TCGGCCAACAAGGTGTACAAGGTGTTGGGAAGTCTGCCGGACAAAGCCGAAGAGCTGGCCCTGGACCGGCTCAACACTAT
GTGCAACCGCATTCAGGAAATTTACGCAGCCGGAGCCCGAGTGACGATCATCTCAGACGGCATCACATACAACGGTGAGT
TGGATGTTAAGACATGATCTGCCCACCATTATTGTGCGTCTTCTGATCTTTCTGATTTTCCAGACCTGCTCTGCATATCC
GACCAAGAGACATGGGCGTATGGCGAGGCGCAGCGCAAGATGGCCGTGCAGAAGCAGTTTGACAACATTGGCTTCTCGCG
GATGCGCGACCTGCTCGAGGTGCCACAGCTGAAGAAGATGCGGGAGATTACGTATGTGGCCAACTGCACCAACTTCCGCC
GGCTGTTGCTCAACAAGTACGGCCGGGACGACCTCGACATCGACCAGGAGATTGCCAGCAACTCGGACACGAAGCTGACG
TATCTCGGCTACAAGCGTTTCCTCGAGTCGGATTTGAAGCACATCTTTCCCCGAGGGGCTGACCGGACGGCCAATGACTA
TCGGTGTGATTGCAAGTACCTTGCGAAGCAGATGCTGATCCGGGGATATGTGAGTTTATACAAGCATGGAAAAAAATGAA
AGAAAAATGAAAGAAAATATAAAAAAAGAAAGAAAAGAAAGAAAAGACCTTCTAACCTTGCCGGCCTTTGCCGGCGCCGT
CAAGGCGGCCTTCCCCCATCACCTGCGGCTGTCGATCCACGAGTCCATCTGCGGCACCAAGGTGTCGATCAGCCTGCTCA
ACACGCGGACCGGCTTCACGACGCCGTGGCACTGCAGCGTGGCCCAGCTGGCCGACGGAACCTGGATCAGCGCACCGATG
GGCGAGTTTGCCAAGGACGACCGGCTCGAGCTCGTCTTCTCGGACGATGATGTCGGCCGGCCTAGCCACTTTCGCGAAAA
GCAGCGCGCCGGCGACGCACCGGGCATTGGTGAGCTGTCGGCCAGCTACCTCCAGCCAGCGCGGCCACTCAGTGCCAGCA
CGTATCTCAGCGGAGCCCTGACACCCCAACAAGAATCGCCCAGCAGCTCGACCGCATCGCTGTCGTCGCCGTCGCAGTCA
GACTGCCAGAGCAGCACAGGGTCTCCTCCCAGCTGCGCCTACTTGCTACTCGCGGACGCCGATGCCGAGACGACTGCATC
GCCTCCATATGGAAGGAGGCTCATCCCACAGATCATGGACAGCCTGGCAGCTGCTGAGCCCGACCGCGTCGTATTCTCGC
TGACGACAATCGCTAGTGACACGCTGCAGTACCAGCCGGTGACAGCGCGGAAGTTTGCCCAGGCCGTCGACAAGACCGCT
TGGTGGCTGCAGGGACAAGTCGGAAAGCCCGACTCGATCCAAGCTTTGGGTTACATTGGACCACGTGAGCCGGATCTGCT
TCTCGATCAACTTTTGTCCGTGCCGGCCAACTGACTCTCTTGATCTCAGACGACTTGCGACACATTCTCCTGACGTATGC
CTGTGTCAAGGTTGGCTATGCGGTACGTCTCCTATTTAACTGCTAGGTGATGCACCTCGGACTGAACCAACATGTTCGCG
CAGGCTCTCTTCCTTTCGCCCAAGAATAGCATAGAAGGCGGGCTGGCCGTGCTGGAGGCAACCGGATGCAACGTCTGGGC
GAGTGCCGGCGACATCACCCCGGTTTCTCTGGTCCAAGACCTGCTGGCAAGGCGGCCGATGAAGGTTCTGCACATGCCAC
CATGGATGCCGTGCGGCTGCTGCCACCAGTTGACGGCTGTGACGGGCTGCTGCCGTGGACGACGGACTGGAAAGTGGGCG
ATCGGATCTACTCGGCCTTTCCGATGAGCCACGGGGCCGGGATGATCATGAACGTCCTGATGCCGGCTCTGTTCCGCCTG
CACTGTATCCTGGGCCCGAAGGGGGTGCTGCCGAACATGGGTCTCGTCGAGAGGCTAGCCGAGACGACGACCATCGACAT
CTGGAGCTTGGTGCCGTCGCTGGTGGACGAGCTCGGCGAGACGGCCTCGGTGCTGACTAAGCTGCGGCCGTCCAAGTTCA
TCTGCGCATCGGGCGGTCCGGTCAGTCCGGTCAGCGCCGGCAAGGTCAACCAGGTGGTACGCGTGCTCAATCTCACGGGC
ACGACGGAAGGTCTGTTCATCGGCAACCTCGTGCCGCCGCGGGAAGACTGGTTCTGGTTCTGCTTCCACCCGCATGCCGG
CTTCGAGTTCCGCGAGCTCGAGCTCGAGCCCGACACGTTTGAACACTGGGTCCATCGCAACGCGTACTGGCCACTCTTCC
AGGGCATCTTTCACACCTTTCCCGACCTGCAGTCCATCAACCTCAAGGTCCTGTACGTGCGCCACCCAGGGAAGCCAAAC
TTGTGGGCATTCAAGGGCCGCAGTGACGACCTCGTCGTGCTCTCCAGCGGCTACAAAATCTCGCCTCTCGACACCGAGGC
CCTCGTCACCACCCATCCAGCTGTCCGGGGCTGTCTCGTCTTTGGCACCGGAAGGCCGCAGGCTGGCCTGCTGATCGAGC
TGCACGACGGTTCCGACCAGACAGACCACCGGCTTCTCGACAGCCTCTGGGAGACAGTCCGGCAGGCCAACAGCCAGTCG
CGCCACCAGAACCAGCTGCTGCGCGACTTTGTTACCATTGCTGAGCCCGACAAGCCCTTCTTTCGCACCGACAAGGGCAC
GGTCAAGCGGTCAGCCACCCTAGCCCTCTATGCCGACTACATCGAACGCTTCTACCACTCGCGCAGCGACGACCACATTG
TCGGCCCCGTCACCATCCATGGCGGCTCTTCTGCAGCGGCCGTCGAGGCCTGAATCCGCGACATCCTGGCCTCGTCGCTG
CCCGGTATCCAGGACGTTGCGGTCGATGCGAACCTCTTCGACCTCGGACTGGACTCGCTGGGCGTCTTTTCTGCGGCCAA
GACCCTCCGGACAGCCACCGGTCTCACCGACAAGATCGCTCCCCGTCACTTGTACGCGAACCCGACGCTCGAAAGGCTGA
CGGCTGCCGTGCAGATCTTGCTGGCTAGGACCGAAGAAGTAGCGACATCACAGGCTGCTGCCCGGCCTTTTGCAAGCATG
GAGGCCCTGGTCCGGCAGCACAAGGCGCGCCAGTCGTTCCGGCTCAATGCGCTCGACTATGTCAATCCGAATCACGGCAT
GGGTCTGGTGTTCTACCTGCCGCTGAAACCGGGCGTCGGCTTCCGGCAGGCCTTTGACCACCTGCAGGCCGGCCTGAATC
GCACTCTGGACATGATCCCGGCCCTTGGCGGCAAGGTCATGCGCTGCTCCGAGCAGGAGATCGGCTTCGTTCAAGACGAC
CTCTGCGTCACCATTCCGCCTCTCGCCATGGCTTCTTTGGTCCATAACCGACTGGTCTGCCGGGACCTCTCGGACGTGCT
GCCGTCGTTTGTCCACCTGCGCGACCACGGTTTCGCACCATCGGCCTTCCACGATAGCCTTGTTCTGCGCGATGACCCCT
TTCCCCAGCTGCCCGCCGACATCTTTGTGGGCCAGGCCAACTTTGTTCATGGTGGCTGCCTCCTCGCCGTCGACATCAAC
CACTGCTGCCTCAATGGCCTCGGCGTCATGGTCGCCATCAAGGCCTGGGCCGAGAACTGTCGCTTCCTGCAGGGTGACCA
GGCCGCCAATTGCAGCTGGTACGATCCCGAGAGCTTCAACCACAGCCTGCCTGAGATTATCCACGAGCACGAGGGCTGGT
CTCGGCCACTGTCCGATATCGATCCCGAAACCTGGGCCTTTCTGCCGTTCTGCCCTCCAGACGACCGACTTCCTCGGTCA
GCCTTCCAATTGCACTCTGTCTGGCCGCCGCCACCGGCTGATCGGCCTCTCCGGACGACCCTCTTCATGATCCGGCCCGA
GAAGCTTGCCCAGATGAAGCGCGACGTTCTTGCCGACCAGGCGGCCCAGGGCATCGCTACACCCGCCAGCTCCATCAGCG
ATATCGTCCAGGCCTTCTTCTGGCGGGCCGCCATCCGGGTTCGATACCGCATCGCCACCGAGGCTCACGGCCGCTCTTTT
GGGCCCGACGATGTCTCCATACTTGAGCTGCCCTCCGACGGCCGTCCCTACTTCTCTTCCTTGCTTCCATCTACGTACAT
GGGCAGCCTCCTCCTTCTCAACCACTCTAGCATGCCCGTCGAGCAGCTCTGCGCACCCAACACAACCATCGGTCGCGTCG
CCTTGCTTCTACGCCAAGCAGCCACCCGAATCACCCCCTCGCTCGTCCACGACGTCTTCTCCCTCCTGCAGTCGCTCCCC
GATCACCCCCGCTTCTCGACTGCCAACATGGGCCTCGACCACATGCACGCCATGATCTCTAACCTGATGCTCTTCCCCAT
GGACGACATCTGCTTCGGCGACAGCCTCTTTGCCAACGCCGGCTCGCCTGAGTCCATGCGTCCCCAGCTCGAACGCGGCC
ATGGCCGCTTCCGCTTCCTCGTCGTCTTCCCCATGAAGAAGGATGGCGGCATCGAGCTCGCGTTGGGAACCCACCCGGAA
GAACTCGACATGTTCCTGGCCGACGACGAGTTTACAAATTACGCCGATCTTGTTGACAGGGCAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62