GenePrediction:GLEAN_8082 Details

Name: GLEAN_8082
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1166595..1165303 (- strand)
Length: 1293
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1166595..1166533 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:1166437..1166373 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:1166278..1166149 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_113:1166088..1165303 (- strand)
Length: 786
>GLEAN_8082 class=GenePrediction position=GCSC_113:1166595..1165303 (- strand)
ATGAATCGGCCACGCGGGTACTCCGGCTCGAGCGATGACAGTTCCGGGACGGCACGCGAGCAGGTGAGATTGAGGCCTGT
GCGGGCAGCGGCCTCTGGGATGGGGCGGTGGACAAGACGGAACGCAAAGCGCTGATGCGTGCCCCCCAACATGTGCAGGA
GCTCGGCAGCATGTACGACTACCTCGCCAAGATCATATTACTAGGCCCGAGCGGATCCGGAAAGTAAGTGGAACAGAGGG
AGGAGAACCGAGTTGGGGGGAAGAGGAGAGCGAGGTGGGGATATGAGAAGAGAAGGATACGGCTGACAAAAGGACAGGTC
CTGTCTTCTTCACCGCTTCGTCAAGAACGAATGGCGTGTGCTGTCGTCACAGACCATCGGCGTCGAGTTCTCGAGCAAGA
TTATCAAGGTTGGCACGGGCGCACGACGAAAGCGGATAAAGCTGCAGGTGCGTATAATCGATTCGATCGAAAACGGGACA
CACACAGACTGACATGCGTCCTTGCAGCTCTGGGACACAGCCGGCACGGAGCGGTTCCGGTCGGTCTCGCGCTCATACTA
CCGCGGTGCAGCGGGTGCGATCCTCGTCTACGATGTGACGTCGCACAAGTCATTTGCCGGGCTGCAGCCGTTTCTCAACG
ATGCGCGGGCGCTGGCGTCGCCGAACTTGACGACGTTGCTGGTGGGCAACAAGCTGGACCTGGCGGCAGACGTGCTGATC
GACACGAGCCTGCCGTCGGCGACGCCGTCGACCGCATCGATCCTCTCCTCGTCGCCGGCTACCATAACAGGGGAGAGCTT
TGCAGGCAGCAGCAGCAGCGGCCGCGGAACCGGAATGGGAGTCGGAACCGGGACGGCCATTGGCCTGGGGTCGCAGCTCA
AGGCCACGGTGGCGCCCGAGGGCCGCGAGGTCAGCGCGGCCGAGGCCAGTCAATGGGCCAGCGGCGTCAGTGTGCCAGTG
GCCGTGGAGGTCAGCGCGCTCAATGGCGAGGGCGTCGACGACGTGTTTGGTCGCATGGCGCGCATGATTCTGACCAAGAT
TGAGCTGGGCGAGATTGACCCGGACGACCCGATGAGCGGCATTCAGTACGGCGATGCAGGCGCCAGCTGGAATGCCGGCG
CCAGTGACGGCGGCAGCATCAAGAGCTACATGACGACCGACGACAGCGGCAGCGGCGGCGGTGCGGCGAGACAGCGGCGG
CGTGGCGGCACCGGCGGCGGCATGGCGCTGCGCGAGTGGGAAGAAGTGTTTGCGCTGCCGAGCCGACGACGACGGAATGC
GTGCGGCTGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62