GenePrediction:GLEAN_8083 Details

Name: GLEAN_8083
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1163684..1162661 (- strand)
Length: 1024
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1163684..1163374 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_113:1163267..1163143 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_113:1163034..1162661 (- strand)
Length: 374
>GLEAN_8083 class=GenePrediction position=GCSC_113:1163684..1162661 (- strand)
ATGACCCACCAAGACGCACCCGCTAACTTACCAGAAGCGGAAGAAGATACCGCCTCTGCTCCCATGGCGGAGGTGTACAA
TACTGACCGGTTCGGTGTTCTGTATGCCGAGTCCCGGTATCCGCCCGTAGCCAACCTTGGGCTGGCGGCTTGCTTCCTTT
GCACCTTCTTCCAGTACCATGCTATCCCCTTCTCCTTTCTGGGTGGGTGGGCCGTGTATCTACGAGGGGGAGGACGCACG
ACCACGGATATCGACGTGACTGTCGATAGCGCCATGAACGTGCTGGAGCGAGCGCTGCAGACAGAGCATCGGTATGTTGC
ACGTCGATAGTATTTTACCACGATCCTGTTCTTTGTGTCCCCGTTCTCCGTGACTCCCACGCGTCTCTGCCGTGCCACCC
CTTCTCACACGTCTCAGCGTGTGCATCCCCCAGACACATGGCCAAACCAGCATCCAGATATTCATACACACCGGCGGCGA
CTGGGATCGACAATGGCCAAACACGAGCACATACACCGTCAGTGCAGACGTCATCATAAGCGGTAAGTGTACGGGGTGCA
CTCACGTCTGCATGCTGCTGCGCTGTACAGTGAAAACCACCTTCGTTCCCTCTGGCCCTCCGTAAGGACACACCTGTATT
AATACGAAAGGCCACCTGGGAACGCCCAATGACCTGCGCTACGGCTACGGAACCGAAGGGATTCTGCCCATTCCTGCCAC
CCCCCATGGCTCCAATTTTGTACCTGTCCTTTCTCTCTTCTACCAGCTCGCCGCCAAGTTTCAGGCCCACAGCTGGCGCC
GTGGCGAGGCCGCCAGCGACTACGAGGACCTCATCTTCCTCATCGGCCAGTACCCCGAAGAGGTCTGGTCTCTGCACGCT
CTGTTTGATCGGAACCACCTGAACGTCTTCTGGACCGATGTGGCTGCCACGCACGGTAGCATGCACGAATTCACGAATTA
TGTCGGCCGTCTGCTAGGACTAGCGGAGGACAGCGAAAATGACGGGAGCACGACATTGCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62