GenePrediction:GLEAN_8084 Details

Name: GLEAN_8084
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1161988..1159318 (- strand)
Length: 2671
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1161988..1161473 (- strand)
Length: 516
Type: CDS
Source: GLEAN
Position: GCSC_113:1161420..1159318 (- strand)
Length: 2103
>GLEAN_8084 class=GenePrediction position=GCSC_113:1161988..1159318 (- strand)
ATGCCCCGCATCATCGTCCCTATCGACTCGGGATGGTCTTTCAAGGCCGTCGGCGAGGATGACAGCCATCGGCTTCCTGT
TAACCAATTTCCGACAAACATCCACCTTGATTTGCTCGCACACAAAAAGATACCGAATCCGTCCGTTGGAAAAAATGAGC
TGCTCGTGCAGTGGGTGGGTGAGCGCCAGTGGGTTTACAGAACCACGTTTCTGACCCCTCATACGACAGACAATCCAACA
GAGAAAACCGTCCTAGCTTTCGATGGCCTTGATACCTTTGCCACCGTTGTACTAAACGGAAAGACCATATTAGAGAGCGA
CAACATGTTCTTGCCGCATCGTGTCGATGTCACTGCCGAGATTACATCTGCTGGTGGCAGCAATGAGCTCACCATCACAT
TTGACAACGCATCACTTCGTGGCTGGAAGCGCATAGATGAGCACCCACACCATAAATGGGGCTGCTGGAATGGGGACAAT
TCGCGACTCGCCGTGCGGAAAGCCCAATACCATTGGGTAGGTTCTTCGACGCAGAGAGATCCGTGACATGGCATGCTAAC
CAGACCAGGGGTGGGACTGGGGACCAACCTTGTTGACATGTGGACCGTGGCGACCAATCTACTTGGAAGTTTACGAGTCT
CGTATCTCGGACTTGTCCTTTCGTACCGAAGTCGACAAAAGTCTGAAGGTAGCCACGGTCACCACTCAAGCTGAGATCGA
GGCGGGACCCAATGTCCCAGAGGCAGTGCGGTTCGATGTCACCCTCGGTGACTCCTTGGTGGCGTCAGAGACCATTTTGG
TTGACTCTGCACTAAAAATTGCTTCAGCCAGCTTTAGAATCAACAACCCAGCATTGTGGTATCCGGTGCGATACGGCCAG
CAGCCATTGTATACGGTTAAAGCGACACTGCTGGCAAGAACAGATAAGCAGCTGAAGGATGTCGACACAACTACAAAGAA
GATCGGTCTCCGACGTGCAGAACTGGTACAACAGCCGCTGCATGGACAAACCGGCACAAGCTTTTTCTTCAGGATCAACA
ACATCTCAATCTTCTGTGGAGGCAGCAACTGGATCCCTGCGGACAATTTTCTGCCCCGGGTCACGCCCCAGCGCTATCAT
GACTGGGTTAAGCTCGTGGCTGATGGCAACCAGTTTATGATCCGCGTATGGGGCGGTGGCATCTACGAACAACAGGCGTT
TTATGATACTTGCGATGAGCTTGGGGTCCTTGTGTGGCAGGACTTTATGTTCGGCTGTGGAAACTACCCTGCCTGGCCGG
CTTTCTGTGATTCGATTCGCCGCGAGGCTGAAGCTAACGTGCGCTTGTTGCGCCACCATCCGAGCATCGTCATCTGGGCT
GGCAATAACGAAGACTACCAGTACCAGGAGAGCGAGGGTCTCACATACGACTACGCTAACAAGGACGCCGAGAGCTGGCT
GCAAACCGATTTTCCCGCACGATACATTTACGAAAAGATACTCGCAGATGTGTGCGCGGCACTCATCCCGGACACGTATT
ACCACTTCGGCAGTCCTTGGGGTGGTGGGGTGGATACACATGACCCAACAGTGGGCGACATCCATCAGTGGAACGTGTGG
CATGGAACGCAAGAAAAGTACCAGGACTTTGACAAACTGGTTGGACGTTTCGTGTCGGAGTTTGGCATGGAGGCGTTTCC
CAGTGTGCGTACAATTGACGCATTTCTGCCACAGGGCCGCAACGACCCAGACCGGTATGCGCAAAGCTCGACCATTGACT
TCCATAACAAGGCTGCCGGACACGAGCGGCGTATTGCGCTGTACCTGGTGGAGAACCTGCGGTATGCTCCGGACCCGCTA
GAGCAGTTTGTGTACTGCACGCAACTGATGCAAGCGGAGTGCTTGGCTTCGGCATATCGGCTGTGGAAGCGGCAGTGGAA
AGGACCGGGCCAGGAGTACTGTGGCGGGGCATTGGTGTGGCAGATCAACGACTGCTGGCCAGTGACCAGCTGGAGCATCT
GCGACTACTACCTGCGGCCAAAGCATGCATACTACGCCGTCAAGCGCGAGATGGCGCCGGTCAGCGTGGGCATGGCGCGG
CGGGAGCACGTCCACATGGGCGGCCGCCATTCGCGAATTGAGACTAGAAGGGAGACGAAGATAGAGATCTGGGGATCCAA
CCTGGCGCTCGAAGATCTCACAGTCGACTGCATTATGCGTGCATGGGACGTGGAAACGGGCGAACAGACATACGAGCATG
TCGTTGCCCACGGCATCACCTTGCTGAAGAACCGATCGATAGAAATTGCAGAACTGGACGTGCCCGTGAGGAAGGCCGGC
GACGAAACACGCACCGTCGTTGCAGCATACCTGGTGACAGCGGGGATGGAAGGAGCAGACGGACGGCAGCTGGCCCGGTA
TGTCAACTGGCCAGAACCACTGAAGTACCTTCATCTGGCGAGGCCGCAGCAATTGGTGGTAAAACTTGCCGAATGCGGCA
CTTCCGTCGCTCTTAGTGCGGAAGTGCCGGTCAAGGGACTGGTGGTAGAGGGGCCAGACAAAGAAGCAGACGACGTGGTT
TTTGATGACAACCTGGTGGACGTGGTGCCGGGCGAGACCGTGCATATCGGTGTCCACGGGGCCAGGCGGGATATGCTATT
CCGTGCGAGATATCTGGGCATGACAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62