GenePrediction:GLEAN_8086 Details

Name: GLEAN_8086
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1154748..1152398 (- strand)
Length: 2351
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1154748..1154702 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_113:1154245..1154167 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_113:1154097..1152507 (- strand)
Length: 1591
Type: CDS
Source: GLEAN
Position: GCSC_113:1152438..1152398 (- strand)
Length: 41
>GLEAN_8086 class=GenePrediction position=GCSC_113:1154748..1152398 (- strand)
ATGTCCAGCCCTCACTACCGCCCTCCCCTGTCTCCTCACAGACTGAGGTGAGGGAAATTTGCCAATGGGTGGAGGCTACC
GATTGCTGTCTCACGTGCACGACTGCTACGTTCTATGCCCTATGGACAGGGGACGTCTACCGGAAACAGCCCTCCTAGGA
CCAGCAAGCAAACAAGCAGACATTGCGCGCATTGCCGAGCCGCAGTTTTTTGCTCGGAATATCTCGCACGTCTATCGGGT
ACCTTTCTGTACGATTGGAGCTGTACTCCGTAGCCTCCCCATTCTCTGGAGAAAGGCCAGGTCCACACCTATCCCCACAA
GTTCGCGTCGCCAAGCCAGCCAAGCAAAGCTTGGCCAACCCAAGTCTACGGATCCCGCCAAACAGGGCAGGGCGCCCTTC
TGTAGCGGCATCAGTCATCTCGACGGGCGCGGGGTTGCACATTGCCGCGATTAATCACCCTATTTTTCACAACTAACTCT
TTTCTTACCTTTCTGCCAAGTAGCCTCTTATTTAGCGATCCGGTGTGGTCGGGCAAGGATACCATTCCCAGCACCATCAT
TCGGAACCTCACCGCTCTTTGGGTCAGTCATCATGACAGCATTGGCTTCGATCACATGTCCGATCCTCGCATCTAACACT
GCACACCACAGAAGGACATCGCTTACAACGACGATGTTACCGACAACCTGACCGTCCTCACGTCCAAGTATACAGCAACA
GAAAACGGCGTGCTGCAGGGTTTGCTCTACGTGCCAGACCTTGACAGTGATGATCCTTGTGCCGATTATGCCCGGCAGTA
TGTGCCGGACTCGGCCGTTCGCCAATCTGATCTCCCAGCCACCAACTACAATCTCATCGCCGTCGCGCCTTGGTTTAACA
GTAGCTGCACCAAAGCCTACCTTGCGTCTGCACGTGAAGATCCGCTGCGTGCCTTTCTTTTCTACGTGCCGACCGGTGAG
CTGGCGAGCACTCCAGACTCTGATTCTGACATCTGGGACTTGGGCGATGGCGGCAGCTGGAAATCAGAGAACCACTACCC
CATCTTTGCTGTTTCCGGCTCACTTGGCAGCGAAATGATGTACCAGCTGGGTCTTTACTCGGGCAACATAACCGAGGTGC
CCAATGGCGACAACATCAGCAACCTCTACAACCCTGACTCGTCTGACTACATACGGATATGGACTCAGCTAACAGTCACG
ACGCCTACGGGACTTCCCAATGTTTGGGTTTTCGTGCTCGCGATTGCGGGCGTTGTGTTGGTCGTGGTCATCTTGACGGT
CTTCCTCATGCATGCCGTTTGGCGGCGCCGCCGGATCTCACTCAGACGACGCGTCGTGGCGGGCGACGTCAACCTCGAAA
TTATGAATATCAAGCGCTTGACTGTTCCCGCCTGCCATGTACACAAGTTTCCTCTTTTCACTTACAGCTATGATCCACCA
CAGTCACCGCCACTACCGAAAGCCGTACCGAGCTCTCCCACCGGTATGACTGCTAGCGCTGCGTCTCCCGCCCTGACTAC
TTCGCAGCCACTCCCATATCAGTCCTCGACAACTCTAGAGGCGGCGTGCCACCACAATGCCTCCGCGCCTGGCTTGGCCG
GTACGAACGATTTTGCCGCTCTCTCCAGCACCCTCGGCGCGGAAAGCCGTGGCGAATGTGGAACTGAGACAAATCGTCAC
GATCCGACCGCATCGTCCACCAAAGCAACGTTTGTAGCAGCAGCCCCTGTGGTGGGCGACCTGGACTACCAGCCTACGTG
CCAGATCTGCCTGGAGAATTTCGAAGACCGGGCCACGATCATCCGCGAGCTTCCGTGTGGGCACATCTTCCACCCAGACT
GCATAGATGAGTTTCTCTGTCAGATCAGTTCTCTTTGCCCTCTCTGCAAGGCATCCATGCTGCCAAGAGGCTACTGTCCG
ATCATCACGAATGCTATGGTGCGTCGAGAGCGCGCCATCAGACGGCTCCGTGAGCGTGTTGACGTGGCTGCCTCGGACGA
CGAGAGCGCGCACGGTCGCATCCGCAGTTGGGGCTCTTCGGTCAGTAAGCGGCTTCACAGCTCCAAGCCACGGCTTCCGC
CGACGTTTAGCGCTTCCATTGAGCTTGCGGCGCAAACAAGTCCTACAGATCCTACAGCACAACGACATGACCGGCGTGCA
GTTGTCTCCGAGGCCACTCGCAGGCGAATGCGCCATTTGGCACGGACAGACGCTGATAGAGAAGAGACTGATAGGCCAAG
ATGTACGTTTCTAAAGAAGAAGCAATGCCGATTCGCCCGAGAAGATGCTGACTGTCCGTCTTCGCCACAGGGAGAATAAT
AGGACGAAAGGTGTTTCCGGGATTTCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62