GenePrediction:GLEAN_8088 Details

Name: GLEAN_8088
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1140070..1138831 (- strand)
Length: 1240
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1140070..1139596 (- strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_113:1139518..1138947 (- strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_113:1138848..1138831 (- strand)
Length: 18
>GLEAN_8088 class=GenePrediction position=GCSC_113:1140070..1138831 (- strand)
ATGGCGTCCTCGTCTCGCAAGCCACGCATGGGGAGCCAGTCCAACATCATGTTTACAAATGCGGTATACTACCCAAGCTC
TGCACTCTACGCAGAAGACACCCCCGGCCAGCTGAACTACAGCTGCATCAGCCTTGTGTACTATGCATTTGCCAAGGTGA
CATTCGAGGGAATTGTCTTTGTAAGTCGTCACCATATTTTCAGGGGGGCGGGGCCAGATGACAAGGCTGACGACCGGATG
CAGCTGAGCGACGAATGGGCCGACGCCGGAGCGCCGTGTGATGGCGTGCAGGGAGCACTGGGGTCTCTGATGCACCGCAA
GCAGGAGCACCACCATCTGCAGGTAGTGCTCTCGATCGGCGGTACCGAGTCGGCGGCGGTGTTTCCGAGCGTCGCAGCCG
ATCCGATCCGACGAGACAACTTTGCGAGATCGGCTCTGGGTCTGGTCGATGCTTCGGGGCTGGACGGCATCGACAGTGAG
CGAGCCTCTGTTTTCCTTCCCATCTGCCGTTTCGGCGCAGACAGCGAGCTGACGGTCCCGGTTTCCACACAGTCAATTGG
GCCTATCCCAGCGACGCCCAGCAAGGAGCAGACTTTCTCGCCCTGCTCGGACAGGTGCGCATGTATCTGACCGAGGACAA
GTACGTAGTGACGGCGTCTCTGCCCGCCAACAAGGACTACCTGCAGGTGCTGGACCTCCGGCATGTAGCCGGCTACGTGG
ACCTGGTCAACCTGGCCGCCTACGATCTGTACGGACCGTGGTCCCCCAAGTGTGGGCACCAGGCTCAGCTGTATGCCGTC
GGCAAGGACGAGAATTCAGGCGCCTCGGCCGTGCAGCACCTCATGTCGCAGGGCGTGCCGTCCAAGAAGATCCTCCTCGG
CATCCCGCTCTACGGCCGCAGCTTTCTCGACACCGCCGGCCCCGGCCACAGCTTTTCGGCTGCCGGTGGCATGGAGGACG
GCACCTTTGAATATCGCGAGCTGCCCCGACGGGGAGCCCGGGAGCACACCGACAAGCGCGTCGTTGCGGCGCAGTGCGTC
GGTGGTGACGGCGGCTTTGTCAGCTACGACAATCCCGAGACCGTTCGCCTGAAGGCTGCTTTTTGCAAGCAGAAGTCGCT
GGGGGTCAGTCTTCCTCCTATTTGCCCATGGTGTGCTTTGCTAACGGACCGCGTGGAGAGAGCAGGGGCTGTATTACTGG
ACAGCTCCATCTGATTCCAAAGACAGCAAGCGAAGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62