GenePrediction:GLEAN_8089 Details

Name: GLEAN_8089
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1137224..1134489 (- strand)
Length: 2736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1137224..1137182 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_113:1137115..1135299 (- strand)
Length: 1817
Type: CDS
Source: GLEAN
Position: GCSC_113:1135241..1134489 (- strand)
Length: 753
>GLEAN_8089 class=GenePrediction position=GCSC_113:1137224..1134489 (- strand)
ATGAGTGGCACCGCCGTGGCTGAGCGCTCGTCTTTCGATTCAGGTTGGTGTGCCCTTGTCCGCCTGTCCAGGCCGCCGAT
TGGTTGCTGACCGAGACTTGTCGTTTCAGCAAACTACAATCCCGTCGAACACCTCAACATCCTCTTCAGCCATCCATCAG
CCGTCAGCTCTCTCCCTATCGTGTCCCGCCGACTCCGAATCCATTCCGATGAGCTGTCCAGCGAGATCGCCGCCATGGAG
ACGGCCCAGGCATACGGGTCAGGGGCGTCTCTTGAGCGGATGCAGTCGGCCCAGACAGAGCTGGCCTCTGTCTTCTCGCG
CATCGAGGACGTGCGATCGCGGGCAGTGCAGACGGAGCAGGACATTACGACAATGACGGCCGACATCAAGCGGCTGGACG
GTACCAAGCGCAACCTGACGGTGTCGATGACGGCGCTGAAGCGGCTACAGATGCTGACGACGGCATACGAGCAGCTGCGT
GGACTAGCTCACACACGACAGTACCGAGACTGTGCCGGGCTGCTGCAGGCAGTGCTACAGCTGATGCGCCACTTCAACAG
CTACCGGTCGATCGAGCAGATTGCGGCACTGAGCCGCGGCGTGGGCGAGCTACAGCGCGAGCTGCTAGAACAGGTGTGTG
AAGACTTTGAGCTGGCCTTTACCAAAGACGAAGTGGCCGTGCGGCGTGGCACGCTGGTCGAGGCCTGTCTGGTGATGGAT
GCGCTGGGCGACAGCGCGCGGACACGGCTGGTGACGTGGTATGTCAACACGGAGCTGCGCGAATACCGCCAGGTGTTCCG
GGGCAGCGACGAGGCCGGCAGCCTCGACAACATCGGCCGGCGCTACGCCTGGTTCCGCCGCACGCTCAAGACACACGAGG
ACGAGCACGCGGCCCTCTTCCCGGCACACTGGCGCGTCAACGAGACGCTGGCGACGGCCTTTTGCGACGGCACGCGCGAC
GACTTCCGCGGCATCCTGGAGCGCAGCATGCGACGGCCCGACGGCGCCGGCAAGATCGACGTCAATCTGCTGCTCAGCTG
CCTGCAGGAGACGCTCGACTTTGAGCAGGGTCTAGAGCGCCGGTTTGCCAGCGAGGCGCCGCGCGCAAGCATCGACACGC
TCGCCTCGTCCGACGGCCGCACCCAGACGTACAGCGGCTCCATCAGCGTGGCCTTTGAGCCGTATCTCAGCCTCTGGGTC
GACTCGCAGGACCGCCAGCTGGCCGCGTTGATCCCGCAGTACCGCACCCGGCCGCTCGTGGCCGACGACGACGAGTTCAC
GCCCGAGAGCGTCGCCCCGTCCGCCCTCGAACTCTTCCACGTCTACAAGGTCACGCTCTCGCAATGTGCCAAGCTGTCGA
CGGGCGAGCGCCTGCTCGATCTTTCGCGCATCCTGGCCAAGTACCTGGACGAGTATGCCCAGCAGGTCCTGCTCAGCTGG
CTGCAGCTGCCGGCCACAGCAGCACAACAAAGTGGCGCCGGCGCCCCGTTGCGCGACGTCATCGTCGTGCTCAACACGGC
CGACTTCTGGAGCCGCAACACGACACAGCTGGAGGAGAGCCTGAAGAAGCGGATCGACGCCGAGCTGGCAGACCGGATCG
ACCTCTCGGCCCAGGCGGACGCCTTTCTCGGCGTGGCCAGCAGCGCCGTGCAGACGCTCGTGCGCAAGGTCGAGGCCGAC
TGCGACGTCGCCTGGCGCGAGATGCGCAATACCAGCTGGGGCCAGATGGAGACCGTCAGCGACCACAGCTCCTACGTGTC
CGAGCTGATGCGCCACGTCGACGGCCGAGCCAAAGAGATCCTGGCCGTCGTGGCCAAGCCGCAGTATGCCCGCGCCTTCT
GCGACCACCTGGTCGAGGCCATGGCTGCGACCTATCTCGCCAACGTCGTCCAGTGCCGGCCGGTGTCTGAGATTGCGGCC
GAGCAGGTGAGTTTTGTCCCTACAGCCTGTCCAGCCCGTACTTTGTTGAGCTGACACACGCAGATGCTTCTGGACAAATA
CACGCTCACCAAGTCGTTTGAGAGTCTCCTCTCGTTCCACGTGCCGTCGACGACGGCGTCCACGGCGGCACATTCGACGG
CCAGCTACGTCAAGCGCGTCAACCACACGATGGGCCGAGTCGACCCGCTCCTGAAGACACTGCAGGTGCAGCCGTCGCCG
CCGGAGAGCCTGGTGCAGGCGTACCTGATCCACATTGCCGACCGATCCGACAGCAACTTCCGGAAGATCCTCGAGCTCAA
AGGCGTGCGGAAACAGGACCAGCCGTACCTGATGGAGCTCTTTGCCATTCACCGTGACAGCTCCAGCGCGTCGGTCCGCC
AGCTGGTCCAGAACTCGCCGCTGTTGACGCCGCTGATGAGCCAGGCCGGCCAAAGCGGCGGCCTTGGCAGCAACGCGGCG
GCCGGCATGCAGAACCGGCTGGACGCTACCAGCATCGGCGAGAGGCTGTTGAATGCGGCGCGCGACGGTGTCGACCGGCT
GGGCACATCGGGCGGCGTCGTCGGCACAGGCGCGACGGGTGGCCTCGGATCGGTGGTCGCGCCCGGGACGTTGGGCGGCA
CGAGTGCCTTTGGCGCCACGGGGGTTGGCTCGGTCGTATCTGAGAAGGCTACGATCAACGAGAACCTCAAGAACATTGGC
AACTTCTTCCGGCGCGACATTGGCGGCTTGGGCGCGCGATTTGGAAAGCGAGACATCACGCCAACAGGCACCAACGAGGA
CGGACAGCGACATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62