GenePrediction:GLEAN_808 Details

Name: GLEAN_808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:134313..137909 (+ strand)
Length: 3597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:134313..134808 (+ strand)
Length: 496
Type: CDS
Source: GLEAN
Position: GCSC_132:136130..136275 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_132:136729..136945 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_132:137014..137060 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_132:137123..137257 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_132:137307..137509 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_132:137570..137717 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_132:137787..137909 (+ strand)
Length: 123
>GLEAN_808 class=GenePrediction position=GCSC_132:134313..137909 (+ strand)
ATGCCTCGAGCACGCAGGCAGGCTCTAGCTACAACGCTGCACGCCGACCATGACATCGATACCTTTGCTGTGCGGGCTGA
CGGCGCCGACTGCGACTCGCCAAAGCGCATCGTCGATGCTGCCGTCAAGCGCTGGGGCCACATTGACATCATTATCAACA
ATGCCGGTACCTGCGACGACAGCCTGCTGGCTGACCTCGCCCACGATCTGTGGGACAAAATCATGGACTGCAACCTGCGT
TTTCCTGTCTTCCTCATCAAGGAGGCCATCCCATACTTTGGCACGGCCCTGCGCATCGTCAACATTTCCAGCGTGCTCGC
TCGCATGGGCAGCGCCTCCACGACCGCTTGCTTGGCTAGCAAGGCTGCTCTCGAGGGCGTCACCCGTGTCTTGGCCACGG
AGCTGAACCAGAAGTACAACGTCGCCATCAATTGCGTCAATCCCGACCCTGTCGCCACCGACATGTGGCTGCGCGACACC
AGCCCTCCGTGCCGAGGTAGATGACATGGCGAAGAATACTCCAGCTGCGGCTCACTTCGCCATCCCCGATGACATCGCTC
AGATCGTCGCCTTCCTGTCTAAGAAGGCTAGCCGCTGGCCCACATGAAACACCGTCAATGCAAACGGTGGCCTTGATTTT
GTGTAGAGGATAGTTCACGTTCATGTCTTACACGTCACGTCAATAGATTAAAAAATTAGATGAGAAATTTTCGAAAAGAA
GTGATATGTGCTCAGCATTGCATTGTGCCTAGGGTATTTCGACTTGTAACGGTACAGGGTCCTCGTTGCTCGGTGCTTGG
TCTCCATGAATTCTTCGTAGTCGAAACAAGTTCATATAAACGACGGGGTAGGCAGCATATCTACTTCTCGCTGCTCGGTT
CTGGTGCCAATGATATGTCAGAGATTGCTTCAAGGATTCTCAAAAGTCTGCAGTTCTATCGGGAGCCTCTGGATGGTACG
TGCACTGTCAAATACGAATGCGTAACCAAGGAGTCCGACCAGGCATGCCACCTGATTTCTCATGACATGTACACGGGCTG
TCCCCCAGGAGTATGTAGAAGTGAGCGAAGCTGCAGGGAATTCCATATCCTTTGCAACAGATATGCGATAATGACTGGAA
TGTAAGATATGATGAAAATGACCACGAACATGGTAAAATATAACTTGAAGGCAGTCAGGACGTGTTTTTTCGTTAGACTA
AGAATGATTTCCTGCGCAACAGAAATAGACACAATGAGGAAGAAAATGGAAAGTCGGATGACCAGAACGATGCAACACCC
ATATCTATGACATCCGTAGAAGCCCGTACATGCTTGTCAATCGGAAAAACTCAGCTGCTAGGGAGCATAGAACAGACGTG
CTTGGCTGGGGGGGCACAAGTGATCACGATCACAGGACAAAGGATTTGAATCTAACCACGAGAATTATCATTTATTCGTT
TTTTCGGTTTATCGATTGCCGAAGTTTTTATCAGCTTTCCCCAAGGCTAAATCAGGGAGTATAAATCGAACCTCAACCGC
CCGGGTTAATGAGCCTGTTGTCTCTTGCATAGCAGCTAAAATCTGGCTTTACTCAGTCCGCTTATTGTCTCAAAAAACCA
ACATGTCTCTTCCGTCTCAGCCGCCATTTAAAGCCATTATCATTGGTGCCGGGTTCTCCGGTCTAGCCATGGCTTGCAAA
CTCAAACGCTCATTGGGCATCGATGACTACTGTGTTTATGATCGCAATGACGGAATTGGGGGGGCTTGGTGGACAAACAC
TTGTGAGTTTTTTAGCTAGCTGCTTGCGTATCACATCTGACAAAGTCTTATGGGCAGATCCCGGATGCGGCGTGGATATT
CCTGCTGTCTGTTACAGCCTTTCATTTGCCCCGAACCCTGGTTTTACGCAAGTCTTTCCGCGCCAAGCCGAGATTCTGAA
CTACATTGCAAAGGTCGCATCGGACTACGGAGTAGACAAACACGTAGTCGGACGAACCGAATGGAAGGGTGCGACTTGGC
AAGAGCACACTAGCACATGGCTAGTCTCTTTGGAAAATCTGACGACTGGCCGATCCTTCGTCCGAGAGTGTTGCATTCTC
ATATCGGCCGTTGGTGGGTTTGTGAACCCAAACGAATCTTCTCTTCCGAATATGCATACGTTCCAAGGACAAGTCATGCA
CACGGCAAAGTGGGACTGGAATATCGAGCTGCAAAACAAGAACGTTGCAGTCATCGGAAATGGAGGCTAGTCACTTCTGG
CGTGGATGTGCCAATCGAGGACATGGGCAGCTGACTTTTCAGCCTCGGCCACACAACTCATTCCGGCTATTGCAGGAAAG
CCTAGGCGACTGACACAATTTATGAGGGTAAGGCAGCAATTGCAAGAGTCGAGAATTGAGCATACACGAAAATTAACAGG
ATACATCTCGTGGTAGACTCCACACCACATCGTCCCAAGCACCAATTATGGCATATCTCTACACCTGAAGCTCGCCTTCC
GATTTATTCCCGGACTTTTATTCCTCGTCAGGATTCTGACTTTCGTCTACATGGAAGTCACCTTCTTTTATTTCCGGACG
ACCGAAGTGGGCCATCGGAAACGGGTACAAGCACGAAAACTAAGCACCGAGTACTTGCAGAGTAAAGCGCCTGGTATGCC
TAGACCTAGAACCTCGCTTATCGCTACTCAAACTAGTAATATATACAACTAACCTTGTTAGGAAAATATTGGCAGCTTTT
GACTCCGACGTTCGAGTTTGGATGCAAGGTGTGCATACGTGTTGCCTCAAAATCAACTGGCCTTATCATCACTGCTGACG
CCAGTTTCAGAGACGCGTGTTTGACCAAGGCTATGTGGACACACTCAACAGACATGACGTCCGTCTGACAGATGAGCGTA
TTGTCAGAGTGAAAGAGCACTCCCTTGTTACAAATTCGGGAGAGGAAGTTCGGGCCGATATTATTGTGAGTTAGAAATAG
CTTTTAGAAGCATTGCTACTGCTGACTGCTGCAGATCCTTGCCACGGGCTTCTCCCTGACACAGTACAACGTACACGTGC
AAGGACGAAACGGAAAGACTCGGGATCAGCACTGGCAAGAATACGGCTGCAAGGCAACTTTCAAGTCTGTCGCCATGCAC
GACTTCCCCAACTTCTTTTACGTTTTGGGACCCAACTCCGGCCGACTGCATACCTCAGCTTTGCTCTCTATCGAAAGGTT
GCAACCATTACAGCTGTCACAATCAATAACTAGCAGCGCTGACGTGTCGTGAGTTAGCTTTGTGGACTTGATTGCCGCCG
TCATTAGGCCAGTTCTCGAACAGCGAGCATCATGTGTACAGGTCATGCACACCAGCGAACAGGCTTACACCAAGGCTCTC
CATTTGGCCCTTAGTGAAACGGTTCACGACAGTTCTTGTTCTAGCGTAAGTCCAGATTAGCGCCCCAAACCTGAAGACGG
ATGTAACGAGCAATCTGACCATCATGCCCTGCAGTACCTTATCGACAAGCAGAGCGGCAAGAATTGGTTCGTTTACCCGT
GGGACACCTTGCAGCTGTGGCTGACGACGCATTGGAGAGTTCTGCGTGACTGGGAATATGAGCCTGCGGGACTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62