GenePrediction:GLEAN_8090 Details

Name: GLEAN_8090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1133697..1130872 (- strand)
Length: 2826
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1133697..1133655 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_113:1133555..1133378 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_113:1133304..1133139 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_113:1133053..1132675 (- strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_113:1132599..1132132 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_113:1131782..1131724 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_113:1131475..1131193 (- strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_113:1131140..1130872 (- strand)
Length: 269
>GLEAN_8090 class=GenePrediction position=GCSC_113:1133697..1130872 (- strand)
ATGGCGACAGAAGTGTACGACGGTGCGATCGGTATCGATCTGGGTATGTCCTGAGCAGTCTTGCGTTTCTGGGCGCGCAG
TCCCGGCGAGCCCTCTCTCGCTGTCTCTCTGTCGAATCAGCCGGCTAACTTGTTTCCTGCAGGCACCACCTACTCGTGCG
TTGCCACGTACGAGGGCAACAATGTCGAGATCATCGCCAACGAGCAGGGTAGCTTTACCACTCCCTCGTTCGTCTCCTTC
ACCGAGGAGGAGCGGTTGATCGGCGAGGCCGCCAAGAACCTGGCTGCCATGAACCCCGCGAACACCGTCTTCGACGTCAA
GTAGGTGCCCACCCAGAAGGCAACCCCACGCCTGAATCGCAATGGGCCATAACCGTATTAATTCGATTTACAGGCGTCTG
ATTGGCCGGCGCTTCGACGACCCGACCGTCAAGAAGGACGTCGAGTCGTGGCCGTTCAAGGTCGTCGACGAGGACGGCAA
CCCCAAGGTCCAAGTCGAGTACCTGGGCAGCACCCACACCTTCTCCCCCCAGGAGATCTCCGCCATGGTTCTCACCAAGG
TAAGTCCAAGGACGGCGGGGCGACGAGGAGCCACTGAAAATTTATTACACGCATGCATTAGATGACTAATCGCCCCGCCT
GCAGATGAAGGAGATTGCCGAAGTCAAGCTCGGCAAGAAGGTGGAGAAGGCCGTCATCACCGTGCCGGCGTACTTCAACG
ACAACCAGCGCCAGTCCACCAAGGACGCCGGTGCGATTGCCGGTCTCAACGTGCTCCGCATCATCAACGAGCCGACGGCC
GCTGCCATTGCCTACGGTCTGGGTGCGGGCAAGTCTGACAAGGAGCGCAACGTCCTGATCTACGATCTGGGTGGCGGTAC
CTTTGATGTCTCGCTCCTGAACATCCAGGGCGGTGTCTTCACTGTCAAGGCCACTGCTGGTGACACCCACTTGGGTGGCC
AGGACTTTGACACCAACCTGCTGGATTTCTGCAAGAAGGACTTTACCCGGAAGACTAAGAAGAGTGGGTCCTCCCGTCTC
CCTTCCGCTTAGCGTCCTTTTTATTCCCGGGACTCTAACTAACACATTCCTCTGTTAGACCTGTCTGGCGATGCCCGCGC
TCTGCGCCGTCTCCGGACCGCCTGCGAGCGTGCCAAGCGCACCCTGTCGAGCGGTACCCAGGCTACGATCGAGATCGACT
CGCTCTTTGACGGCGAGGACTTTAGCATGCAGGTCACCCGTGCCCGTTTCGAGGAGCTGAACAGCGTCGCCTTCAAGGGC
ACTCTTGACCCCGTCGCCCAGGTTCTCAAGGACGCCGGCATGGAGAAGTCGGGCGTGGACGAGATCGTCCTTGTTGGCGG
CTCCACCCGTATCCCGCGCATCCAGAAGCTGCTGAGCGACTTCTTCAACGGCAAGAAGCTCGAGAAGAGCATCAACCCCG
ACGAGGCCGTCGCTTACGGCGCCGCCGTTCAGGCCGGCATCCTGTCTGGAAAGGCCACCTCGGCCGACACCGCAGACCTG
CTGCTGCTCGACGTCGTCCCCCTGTCTCTAGGTGTCGCCATGGAGGGTAAGTCACATGCACAACATTTCCATCCCCTCCC
CTACCAGAGAAAAAAAGAGAAAACAGCACCTCTTTCATTTTTTCCTTCTCTTTTCTCATCTCTTTTATCCGTCTTCTTTC
TTACTTTTTATTCTCTCCTTCTACGTCACTTTGCTTTCATACTTTCAACTTTACATCGCATCACACGCTCCTCACTTTTT
CCCCCATATTCAATTTCTGTGCTCCCTCACCCTCAATTGACCCACTTCTTACTTGCTCGTCATTTTCACCCTTGTGTTTC
CTTCACCCTCCCTTATCAACTTTGACCTTTGTGCTCCCTCAACAAACATCCGCTGACTCGTTCCTTCCCGATTAGGAAAT
ATTTTTGCCGTGGTCATGCCACGTGGTTCGCCCATCCCGACATTGAAGAAGCGGGTAAGCCTTTGACCGTTCCATTGATG
TTTCCTACCTGATGCTTTGATGTTTCGACGATGCTTTCTTTGATGACATTTTGAGTGGGTCCACTTTTGGAAAGGGTCCA
TTTTAAAATGTCGGGAAGATCTGAAAGTATCCACTTCTCGGAAGGCCCCACTTTACAACTTGACGGCCTCGAAAACTTTC
ATCTTTCATTCCAGTTTATTCAGGCCTCTCTGGTTTTACCACAGCTAACGCTTAGTCATCAGTCGTTTACCACGGTATCG
GACGGTCAGACCACAGTATCTTTCCCGTGCTACCAGGGAGAGCGTGCCAACTGCGAGGACAACACGTCTCTCGGCGAGTT
CACACTGGCGCCCATCCCGCACATGCGCGCCGGTGAGCCGGTGCTTGAGGTCATCTTCGAGGTCGACGTCAACGGTATCC
TCAAGGTGACTGCCACGGAGAAGACCTCTGGCCGCAGCGCCAACATCACCATCAACAACTCGATCGGCAAGCTGTCGAGC
GCTGAGATCGACAAGATGATTGGCGGTACGTTTTTGATTACATAACTTCCTTTCGGAACATAATGCTGATTGTTTAGATG
CCGAGGAGTTCAAGTCCAAGGACGAGGCGTTCAGCAAGCGCTTCGAGGCCAAGCAGCAGCTCGAGTCATACATCTCGCGT
GTCGAGGACATCATCTCGGACCCGACGCTGTCGCTCAAGATCAAGCGTGGGCAGAAGGACAAGATCGAGCAGACGCTCAG
CGAGGCCATGGCCCAGCTGGAGATTGAGGATTCGTCGGCCGACGACCTGAAGAAGAAGGAGCTGGCCCTGAAGAGACTTG
TGACCAAGGCCATGTCGCAGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62