GenePrediction:GLEAN_8091 Details

Name: GLEAN_8091
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1125083..1122827 (- strand)
Length: 2257
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1125083..1125060 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_113:1124855..1124118 (- strand)
Length: 738
Type: CDS
Source: GLEAN
Position: GCSC_113:1124038..1123435 (- strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_113:1123320..1122827 (- strand)
Length: 494
>GLEAN_8091 class=GenePrediction position=GCSC_113:1125083..1122827 (- strand)
ATGACAGACGACGCAGCCAAACAGGTATCAAGACGGAGAAAGAGTGGAAAAGAAAGGCGGTAGGAGCCTGCCGAAAAAGC
TGCCCTTCGATGTCGAATCTCTTGTTGTCCTTTTTTTCGATGAAAGAGACGGCCTCGAAGCTTCAAGCCGAAACTAGATT
CGGACAGGCGTCAACTTTAAGCCGGCCGTGTCGGCCAATCAAACAACTACCCTTCTCCCTGCTCCAAGCTAGCCCGACCG
CGCGCCCGTTCCAGCGCCAGCCCCTACAAAGACCGCTGTAAGCTGGGGCATTCAGCCCGCGGCCGAGAAGAAACAACCCC
GCCACTCCCCGGAGCTTCTTGGAGCCATACCACTTGGTTGGGCGACCAGCCGCCTTTGAGCAGCAGACACCACCACGACC
AGAGAGTTGTGTGCGCGCGGCCAGCTGCACAGTCTCGCTTTCTTTTCGTTTCTGCCGCCGCCGACGCAGTTGCAGGCGCA
AGTCGCAAAGTCGCTAGCCGCCGAGCTTTGCGAATCTGGGCTTCGGCTTGGCAGAAAACCCGACAACAAAACAGCAAAAG
CAAGGGCACCCGGCGACAGCCCCTGTCCCATTCGACGCGGCCTATCGAGCGCATCTCTCTCGCGCGTCCTCTCTCGTCCT
GCGACAGTCGTTGTCATCCGCTGCTGCCATCCGGCCGCAGCCCGCCCACAGCCCGCGACGATGAACACGTCCGTCCCCAA
CATCCTCCGGCCAGGAGGGTCGAGAAACACGCCGCTGGGTCTGGCCGACATCCGACCCCGAGCCGACTAACGACCCTCTC
GGACGGCTTCTCGAGCGGCTATGACCCCGCCAACAGCCAGCCGGGCACCAGCAACTACATGACGCCCTGGGCCATGTACG
CCTTTGACTGGTGCCGATGGCCATCGTCGGGCAACGGAGCCGGCAAGCTGGCCATTGGCAGCTACCTCGAGGATGGCCAC
AACTTTGTATGTTTTCGCCGCCGGAGAACGGACAAGCCTCCCGGGTGTGGCCCGGTGAACTCCCTCCTCCCGCTGACGCC
CGCAGATTCAAATCCTCGACACCCACATCACGCAGACCCCCATGGACGCCTTCTCGCCCGGCACGTCCAAGTTCTCGATG
GAGTTCACCAAGGTGGCCGAGGCTACGCACACGTATCCGGTCACGCGGCTGCTCTGGGAGCCGCCGTCGCCGCAGAAGCA
GTCAACTGACCTGCTTGCCACGTCGGGCGATCATCTCCGGCTCTGGTCGCTGCCGTCTGATACGCCGTCCGGCGGAACTA
GCAGCAGCACCATCGGTCGCGGCCGGGCTGACGCTCCGCCCACTAAACTCACGCCGCTCGCCCTGCTGTCCAACTCCAAG
ACGCCCGACCATACGGCGCCGCTGACCTCGCTCGATTGGAACACCGTCTCGCCCAGCCTCATCATCACGTCCAGCATCGA
TACCACCTGTACCATCTGGGACATCCCCTCGCTTACGGCCAAGACCCAGCTCATCGCCCACGACAAGGAGGTCTATGATG
TCCGCTTCTGTGCCAACAGCATGGATGTCTTTGTCAGCTGTGGCCAGGACGGTAGCGTCCGTATGTTCGACCTGCGCAGC
CTCGAACACAGCACCATCATCTATGAGCCCACCGGCAAAGATGAAAGGGGTATGTCTACTTTTTCTCGTTTTTCTCCTTC
TCTCTTTTTCTTCTTCTCTCTCTCCTTCTCCTCCCTCTCTCCTCCCCCTTCTCTCCTTCTCCCTCTCTCCCTAACACCCA
CAGATGCCCAAGGCGGCAGGATAAGTCCCACGCTCGCCCAGCAGACAATGTCCCATCCCCCCCCGCTCCTGCGCCTGGCT
ACGTCCCCTCACGACACCCACCTGCTCGCCACCTTTGCCCAGGACTCAGACGTTATCCGCATCCTCGACGTCCGCCAGCC
CGGTCAAGCCCTGCTCGAGCTGCGCGGCCACGGCGGCGCCGTCAACTGCGTCGAGTGGTCGCCACACCGCCGCGGCATGC
TAGCTTCGGGCGCCGATGACTGCCAGGTCCTGATCTGGGACTTGCTTAACAGCGGCAACACAGCTGCTGCTCCCGTCCCT
CCCGGCGTCCCCGCCAACGGAGGCCCACAGCCCGACAACGCGCGCGCACCCGTCGCCGCCTGGCAGTGCGACTATGAAGT
CGGAAACCTCGGCTGGGTTCCCCGGCTGTCAAACAGCGACTACGGCGAATGGCTGGGCGTCAGCGGCGGTCGGGGCATCT
GGGGCGTGCGCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62