GenePrediction:GLEAN_8092 Details

Name: GLEAN_8092
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1119527..1118976 (- strand)
Length: 552
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1119527..1119525 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_113:1119429..1119354 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:1119275..1119233 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_113:1119129..1118976 (- strand)
Length: 154
>GLEAN_8092 class=GenePrediction position=GCSC_113:1119527..1118976 (- strand)
ATGGTGAGTTCTGCAGATTGCATCCCTTTTTCCTTCCCTGTCAGACTGCCGAAAGCCAGCTGGGATTCTAAACGAAAACC
GAATCGCCCTCTGTTCAGTTCCTCAACTTGCTGACCTTTGGACTGTGGGGAAAGCTCGGAAAGCTTACCCACTACGCATT
CGATGCGGTTCTCAGTACGTGTCTCCCAATCCGTGCAGCCACGGGGACGATCGAGTAGCCAGGGAATCATGTACTCACTG
TCTTTCTTATAGTCTCCGCCTTTCTGGCCGGCATGAAACGATCGACCGGCTTAACGTGAGCAGAATCGAGGAGAAAGGCG
GCCCAACCAAGGCCCAAACGAATTGCCGTGCCCAGTGCTTGGACTAACAGTGACCTCCCTCGCCCTCTGGGTTGGGAGAT
TTGCTAGGGCCAGTTTCAAGACCGACAAAGCCTCTGGCGAGAACAAGGACATGAACAAATGGATCGACAAGTACCTCGGC
GTTGGCGAATGGGTCATGGACCAGTCTGTTGCGCTGGCCGGCTCAAGCAGCTGGTTTGAGCGGACACGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62