GenePrediction:GLEAN_8093 Details

Name: GLEAN_8093
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1115351..1111493 (- strand)
Length: 3859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1115351..1115031 (- strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_113:1114869..1114707 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_113:1114649..1112245 (- strand)
Length: 2405
Type: CDS
Source: GLEAN
Position: GCSC_113:1112176..1111493 (- strand)
Length: 684
>GLEAN_8093 class=GenePrediction position=GCSC_113:1115351..1111493 (- strand)
ATGGTCGTCCGGACGCCGGCCAAATCCACATCGGCAAGCCAAAAGCTGTCCCAGTCAACGGGAAAGCAACAGAGCATTCT
AGGCTTCTTCTCCAAGACACCCACGGCAAAGACACCATCTACGGTCCGGCCATCGACAACGAGGACTCGTACCGGTGTGA
GCATTGACGATGAGACCGCTCTCTCATCACCTTGTCTGCGTGAAACAAAGGCCAATGCCCGGGCTTCAACGCGCCCTCAG
GTCACGCCCGTTCCCAGCAGTGATGCATTAGAGCCGCCTAGCTCCCAGGAAAATGCCAGCTTCTACGGCTCTGCATCAAA
GGTACCGAAGAACGCCGACCGCCTCTTGTGACTCCCGCTAAGCCAATTCAGAAGTCTGCAAAGCACTTGACTGTTCCGAC
CAGCAGTCCACCTCGGAAGGTGAGCAGCATATGCCCTCCTCATCTCTCATCACAGTTCTGACAGGTTGCTCGCTGTGAAC
AGATAAAAAAACCGGTAAACTACGCCGAATCTTCGGACGAGGAGGAAGATGTCTTCGTGTCCATGAACACAACACGTCGT
AACAGATCTCGAGCCGTTGCAGACGATGACGATGACGATGACTATAACGACATCAAAGAAGTCCCGGTCGTTGATCATGA
AGATGGTATGCCACTCTGCATCGATGGTACCAAGACATGCTTTGCTAATCTGCTATCTCTAGACGAAATGGCCGACTTTG
TTGTCTCGGACGAGTCCGACGTCACGTCTAAGGCTGCAAAGAGAAAACGTCCCACTAAGACTGAGGCGTCTCGGAAACGG
CCAACACCCTCGCCGACACCGATGAAGGAGGAAGATTACGACATGGATGACGAAGAAATCTTCAACGAAGTGCAGACGTC
CACGGCACAAAAGTGGCGCTTTGATCCAGACAATATTCAGCCCTCTGATCCGTCTTCCAGAGCTGTCCGTGCTCCCGCTC
CCAAAGCTGCGAACCCTAAAGCCAAGGAAAAGGCCTACACCAGAGAGCCAGAGGAGAGGTACTCATGGCTCGCCAACATC
ATGGACATGAACCGCAACAAGCCAGGCCACCCAGACTTTGATAAATCTACGGTATTTGTTCCTCCTAATGCCTGGAACAA
ATTCTCGCCCTTTGAGAAGCAGTACTGGGAAATCAAGCAGAAGCTCTGGGACACAATCGTGTTTTTCAAGAAGGGCAAGT
TCTTTGAGCTCTACGAGAACGATGCCACCATTGGTCACCAACTCTTCGACTTGAAGCTGACGGACCGCGTCAACATGCGT
ATGGTGGGTGTGCCTGAGAGCTCGCTCGACATGTGGGTCAACCAGTTCGTGGCCAAGGGCTACAAGGTAGCTAGAGTCGA
CCAAATGGAGTCAGCACTGGGGAAGGAGATGCGGGAACGGGGTGCGTCGGCAGTCAAGTCCAAGCAGGACAAGATCATCC
GTCGTGAGCTTGCCTGTGTTCTCACGCGCGGTACTCTGGTTGAAGGCAGCATGCTTCAGGACGACATGGCTACCTTTTGT
GCTGCCATCAAGCAAGACGTTGTTGATGGCAAGCCTGTATTTGGCATCGCCTTTGTGGACGCGGCCACAGGCCAATTCTT
CTTCTCAGAGTTCGAGGATGACGCAGAACTTACCAAGTTCGAAACGTTTGTCGCCCAGATGGCACCACAAGAGTTGATTT
TGGAGAAAAATTGCATTTCCACCAAGGCACTCCGCATCCTCAAGAACAACACAACACCCATGACTATCTGGAATTACCGA
AAGTCGGGGAGTGAGTTCTGGGACGCCGACACTACCCGGCGAGAGCTGGACTGTGGTGGCTACTTTACCGCTGACGATGG
GGGCAACGAGGACTGGCCAAAGAAGCTCGCCGAAGTTAGAGAGAAGCCTTTCTTAATGTCCGCTTTTGGGGCCTTGGTCA
ACTACTTGCGCGATCTCAAATTGGAGAGGAACCTGGTTAGTCAGGCAAATTTTGAGATGTACAACCCTATCCACCGAAAC
GGAACTTTGATCCTTGACGGGCAGACCTTGATCAATCTAGAGATCTTCTCTAACACGGTCAACGGTGGACCGGAAGGCAC
GCTTTTCAATCTACTGAATCGGTGTATCACGCCGTTTGGTAAGCGTCTATTCCGGAAATGGTTGTGCCATCCGCTATGCG
ATATTCGGAAAATCAACGAGCGTCTGGATGCCGTGGACATGCTGAATGCAGACCGCAGTCTCCGAGATCAGTTCTCGTCC
GAGATGTGCAAAATGCCCGATCTTGAGCGCTTGGCGTCCCGCATCCATGCTGGCTCGTGCAAGGCGGAGGACTTTGTGCG
CGTCCTCGAAGGGTTTGAGCAGATAGAGTACACTATGGGCCTTCTTCGTGTTTTGAACGGGGGTAACGGCCTCGTTGATC
GACTGCTGGCGGCAATGCCCGACCTGAACGAACCTCTGAGCTACTGGAAGACGGCCTTCGACCGAAAGAGGGCCCGCGAG
GACAAGCTCCTGATTCCGGAACGAGGCATCGACGAGGACTTCGACGAGTGTGCAGACGCCATCACAGGCATCAAAGGCAA
GCTGCAGTCGGTGCTTGAAAGGAGCAAGGCTGAGCTGAAGTGCCGAAATGCAAAGTTCACAGATGTCGGCAAAGAGATCT
ACCAGGTGGAGGTTCCTAAGGCTACCAAGGTGCCCAAGTCCTGGAGACAGATGTCGGCAAACAACGCTGTCAGGCGGTTC
TATTTCGCCGAGCTGGACGAGCTTGTGCGGGGACTGCAAGAGGCCGAAGAGACCCATTCGCAACTCACTCGGGAGGCTGC
GCTGCGTTTCTGCAAGCGTTTTGACGCCGATGCCGAAATTTGGCAGGAGGCCATTCGTATCATTGCGCAGCTGGACTGTC
TTATCAGTCTAGCCAAGGCATCGTCGTCGCTCGGCCAGCCCAGCGCCCGGCCTACGTTTGTAGACGAGGAACGCAGTGTG
GTTGAGTTTGAGGAGCTCCGCCATCCTTGCATGCTCAACACGGTGGATGACTTCATCCCCAACGACATTCGTCTGGGTGG
CGATGCGGCTAATATCAGCCTTCTCACTGGTGCCAATGCTGCGGGCAAGTCGACTATCTTGCGCATGGTACGTCTTTCAT
TTCTTTCCGCCTGTGCTGCCTTTTCCCTCTGAAGGATAGATCTAACACCTGCAAGTCCTGCATTGCCGTCATCATGGCTC
AGATTGGCTGTTACGTACCGGCTGTCTCGGCGCGGCTGACGCCCGTTGACCGGATCATGTCACGTCTGGGCGCCAACGAC
AACATCTTCGCGGCGCAGTCGACCTTTTTTGTCGAGCTATCCGAGACAAAGAAGATCTTGTCCGAAGCCACGCCACGGTC
ACTGGTCATCCTGGACGAGTTGGGCCGCGGCACCTCCTCGTATGACGGCGTGGCCGTTGCCCAGGCAGTGCTCCACCATG
TGGCCAGTCACATTGGCTGTGTGGGATTCTTTGCGACTCATTACCATTCGCTAGCGACAGAGTTCGAGAACCACCCCGAG
ATCTGTGCCAAGCGCATGCAGATCCTCGTGGACAACGAGAACCGACGGGTGACGTTCCTTTACCGGCTGGAGGACGGCGT
GGCGGAGGGATCCTTCGGTATGCACTGCGCGGCCATGTGCGGAATCCCTGACCGGGTGATTGAAGAGGCCGAGGTCGCAG
CGCGCGAGTGGGAGCATACGAGCCGGCTCAAGGACAGCCTGGAAAGGGCCAAGACGGGATGCTATATCCCGCTGGGCGTG
CTCAGTGATGTGGCCACGCTGCTCCGGGAAGACACTGGATCTGAAAGCCTAGACGCGCGTGGCATTGACGTTCTGGCGCG
GGCCATCGAAGCGCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62