GenePrediction:GLEAN_8094 Details

Name: GLEAN_8094
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1107451..1104002 (- strand)
Length: 3450
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1107451..1104002 (- strand)
Length: 3450
>GLEAN_8094 class=GenePrediction position=GCSC_113:1107451..1104002 (- strand)
ATGTCTGGAAGGAGCGCATATGTTCGCAAGAAGATCACACAGACCAAGGTCGACGGCAACGGCAAGGGTGTGGCTCGATC
CGGGGCCAGATCCACCACCAGCTCGGAGGAAAATGCAGGCTTCGAATTTGCCATGCCGGCGAGGCAGGACACTGGCATAG
GTACCACTAATGCGCGCTTCCTGAAGTTTTCTGAGCCTATCCGCGAGGTGGAGCCGACAAATGGTGGTTATCGCAACGAC
ATAGGGGGGGGCGCAAGCTCTGAAAGTCAGAGCGGTGACAGCGTGGATGGCCGGCAGGGCGGTCCAGGCGGTCACTTCAG
AGGCGGCCCTCTGGAGGATTTTGCATACGCGCGAGCGCGCCGGCCTAACATTAGGACAGAAGACGTGTCGGGCATCGAGA
AATCAGGTTTGCGCTCGGCTGTCGATAGGAAGAGTGAAAATGTGCGCCGAGGCCTGGTCAAGGCGTTTACCTTTGGCAAG
AAGCACAAGAACGAAGACAAGGATCCCGACTTCCGGCCGCTCTCTGCGGCAACTGTTCGACCACCGCTGGGCAGTGATAC
ATCCGGCGAGCATGACCAGGCGCATGAATCTATGGACTCAATGGTTGCCCAACGCCTGGCACAGCAACAGCAGCAACAAG
AGCATTTCCAGCAAGCCTACGGCTCACCAACGAGCGACAATTCATGGGACATTCCTGGCAGTGCGATGCATCCGCCACCC
TCGGCGAAGCTTCCTCCTATACCACCGGCTGCGACGGCGCCACAAATCAAGCGCTGGATCGGAGCCGGCCGACCGGTACA
GAGATGGAACAAGCTGCGCAAGGACCCGGAGCTCTGGGACCCAAACGGAGATGTTCTCGTATTTTTTGGACATAAAGGAC
AGCAGCCGCGGCCAAACCCTTCCTTCCGACTGTCGTCGCATATCGTCGAAGCTACAGAATCTCGGTACCTCATCACACAG
CTGCGAGAGGGATCGACGGAAGAGGACATACAGCTGCCCCCATCTCCAGTCGGCGCTCCACCCATGCTCCAGCGGCACCT
GGCTGGTGCAAGCGGCCACCAACATCGTCAACAGCATCTGGGGCTGCAGGGCTATGGCCACGGTTATGTCCATGGTTACG
GCCAAGGCGGACATGGCATGGGCCAGCCTACGCCACCGATCTCGGAGGACAACAGCTTGAGAGAAGCCGATGGCCAGATC
AGCTACGAGATGTACTTCCCGACACCGGCGAATATGAGCAAGACGGACCAGCTGCGGCATCACATTACGACGCGCAATGT
GCTTGCACTGTTGTACCACGCCTCCCTCGTCGGGCTGTCGTTGTATCAGGCGCTGTCAGACTTACATGCGCGACTCGAGG
CGTATATGCCGCCAGAGACGGACAACGTTGGAACGATCATTAATTATCTAGGAGCACGTGGCATAGACGACGTGCGCAAC
GAGCCCGATGCTGCCGTGTCGATCCTTGCGTGGTCAGAAAGTCCGGATGTGCGGTGGGAGGAGGGCTGGCGCGAGTGTTT
TTTGCACTGCGCAGGCATGTATGCCAACCTGGAGGCATGCGCAGACTTCAAGAGTGTGACGCCAATCACACGCGCCCTTC
TGGAACGAGCCTGTCTCGAGACGCAGCTGCGCGTGCAGGCAGCCGAGGAGCGATTGGCGAACTTCCACTACGTGGATATG
TGGCCGGGGGCCGTGGCGTCTGTGTCCAGCATGGGCGGGCTGGCGATGAAGAGCCCGGCGAAGGGGGCAGCAGATCGGCT
GCAGAAGTTCCTGATCGCACACTACACGCGCGCATACGGGCGGTGGCCACCGCTGCCGCCGCCCCCAACGATGATACAGT
CGGGATTAGCCATTGGAGGCGGCCAGGACGACGACATGTGGCTGACACGGACGGTGGCACATGCCATCCAAAAGGACTTT
GCGGCCCTGTACGACTATCTCGTGGATCGTGACATTGTGTGGGACGGCTCTGAGGCACGTTCGGGACGCAAGTGGATGCT
GGTGTCAGAGAGTGGCAACAAGGCGTTTGAGGCGGACACGGCGGACCTTCCGATGACGGACATGCTGGTCGAATTTGACA
ACCGACTGCGGTTTCCACACATCCCACATCCCTACCCACTGGTACCGGAGTCGGAAGCGGGAATGAGCAGCCGTGCAGGG
GCAGTCGAGCGTCGAGTGCAGCTGGCGTACACGGTGGCGACGAACATGTTGGTGCTGGGTTCTGAATTCACGCAGTCGGA
CCTGATCGATGCGTTCTCCAAGTTCGAAAAAGCGGACCGAGTTGGCGACGTGGACCCTTCGACAGCACGGCGCGGGCGAT
GGGTGCTCATATATGGCATACTGCAGACACTGGCTTCGGTGGCGGTAGACGCGCTCAACATGCGGTACCATGAGGGCGTG
GCCTACCATTTGTCTCCGCGGCTCAAGGGTGCCAAGATGCCGCCTTGGCGGACTACCGGCGGTGGCGGTGACGAGGCGGC
CCACGAGCTGTCACACTGCTGGGTGGTTGCAGACACATGGAACGCGACCAACCAGGGTGACAACATCAACGACGAGAGCT
CTGCGTCGTCGGCGGGCGGCGGTTCAGGAACGACGAGCCCAGCACAGCGGCACAGCGGTATCGGCGGCAGTGGCAGCAGC
TATGCCTTCCCACGGCCACCGACAATGGATAGCATGACAATACGGAGCGGTTCGACAGGCTACCTGACGTCGTACGGCGG
CGGTGGCGGCGGTCAGTCTGTGCGATCGGGCGTATCTGTGGCAGCAGTGGGTGGTCATGGAGCTGGAGGTCCACATGGCA
TGCCTTACAGCGGAGGTGGTGGTGGCAGCGGAAGCGGCCATCTGCCGGCGCCGTTTGGGTCCTTTGGCGTATACACGCCT
TCGCCGACAGGGTCCGTGGCCGGTGGCAGCAGCGTGATGTCCGAGGCCTCGAGCGCCGGTCCGTCATCGTCGTCGGCACT
CCGGGGAAATCGGACACCGAAGATGGCCCGGACGTTTGGCCAGGGAAGTATGGGTGCGGGTTTGACCAGCCCTGGTACGG
GCATCGGGCGTATGGAAGATGTGGACTGGTCAGAGGCAGCGGTGCGTGAAGCAAACAGCCGGGCTGGTGGCAGCGCCGAG
AGGAAAGGACCGACCCGTGGCCTACCACCGCTGCCTAGGCTGCCCAACATCCCCAGGGAGCCGTCGTTGGCGGAAGCTTT
TCTTGATGTCGAGAACTCGCCGATCAGCGAGATCTACAGCAGCTATGGAACTGGCAGTGGCAGTGGTAGCGGCAGCGGCA
GCGGCAGCGGTACTGGCAGCGGAAACAACAGCGGCAGCGAGCGGGAAGGCAGGAGAAGGAGAGAGAAGAGGAGCGACAGA
CCACTGCTGAGCGGTGATGGCGACGAGACCGACAGCCTGGCCCCGGTTATTCGGGACTTTGACGATATGGCGGATGACCA
GGAGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62