GenePrediction:GLEAN_8095 Details

Name: GLEAN_8095
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1103062..1102326 (- strand)
Length: 737
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1103062..1103009 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:1102910..1102326 (- strand)
Length: 585
>GLEAN_8095 class=GenePrediction position=GCSC_113:1103062..1102326 (- strand)
ATGGTGTTCGCAGTCATCTTCGCCTTTTGGCGCGTCATGCAGATTATCACGCTGGTACGTATCTGCTGGTCCGGTCATTG
TCTGGCTCGTCGCCTGCTCCTCTTTCCCCTTCTCGTATGGGCGCGCTGACCGACTGTTCCCGCCGGCTCCAGATCCCGAC
CATGGGCATCCTCGCCTGGTTTGTGCACGGCTTCATCAGCGCCAACGAGCTCACGCCCAATTATGTCCTCATTCTCTTTA
TCACGTCGGTCCTGGGCGTGGCCTGGTGCCTCTTCACCATCTTCAGCTACCACCGCAGCAGCATGAACGCGCTCTTTGTC
GCGCTCATCGACCTTGGCTTTGTCGGCACGCTGATCGCGGCCGTGTACGAGCTGCGGTTCATCGCCACGGCCAACTGCAC
GCACATCTCCGCGTCCGATCCGTGGGTCGTCTCGGCCGGCCTGATCACAGTCAGCGGCCAGGGCATCAGCATCAATACCG
ACAAGCCGTGCGCGATGCTCAAGACGGCCTTTGCCTTTGGCATCATGAACTGCGTCTTCTTCTTCTGCACTGCCATCCTC
GCCTGGATGCACGGCAGCCGCCTCAGTACGACCGAGGGCGACCGCCGCTACGTGCGCGAGACCACCACGCGCGTCCACCG
CCGGCGCAGCGGCAGCGGCAGCCACCGACCGGCCAGCCGCAGCCACCACAGCCGCAGCCGGCGCAGCTCCCACTCCAACC
AGCGGGTGTACGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62