GenePrediction:GLEAN_8099 Details

Name: GLEAN_8099
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1082382..1080416 (- strand)
Length: 1967
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1082382..1081946 (- strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_113:1081891..1081786 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_113:1081724..1080540 (- strand)
Length: 1185
Type: CDS
Source: GLEAN
Position: GCSC_113:1080493..1080416 (- strand)
Length: 78
>GLEAN_8099 class=GenePrediction position=GCSC_113:1082382..1080416 (- strand)
ATGGCCGAGCTCAAGCTGCCGCTGACTTCGACTAATGTCCGAATGCGGGAGCCGTCGAGACGGACGTCATGGCGGCTGAA
GACGGCTCTCTTTGCCGGTGTCGTGCTGCTGTCTAACAGCTACCACACTGCCACGACAGGCTCGTCCTTCTTCCGCCGGC
TGGTCTCGTGCCACCACCCAGCTGCCGTCACACCGTCATTGCCGCAATGCCCCGCCCAGAGGGCGATTGGACCGTCGGCT
CGGCCTGACATCACGGAGAACAATGTGCAGAAGCTGTTCCGATCGGCGGAATTTCGCAACCTGAGCGTCAGCCGTCTAGC
TGGTGCCGTGCAGATTCCGACGCAGGACTTCCAGGATATGGGGCGTATGGGCGAGGATGCTCGTTGGGATGCCTTCTACG
ACCTGCAGAAATATTTTGAGGAAACGTTCTCGCTCCTGTAAGTGGCTTACGTGGCCAATGGCTAAAAGTTCACTTGACTT
ACACCAGGCAGACACGAGAAGCTGCAATTTGAAGTCGTCAACGAGCATGGCCTCTTGTACACGTGGCGAGGTAGCAACAA
GACACTTAAGCCGGTGCTACTTATGTCACACCAGGACGTAAGTTGCTATGTGTAGAGTATTTGGGACACGAGACCGGAAA
GGAGTGCTAACATTGCAGACGGTCCCGGTGGCCGCAGACACATTTGCAGAGTGGCGGTATCCGCCTTTCAGCGGGCACTT
TGATGGGACCTACATCAACGGGCGCGGCAGCCACGATTGCAAGAACAACGTGGTGGCAATCCTGTCGGCGCTGACGGCAC
TGCTGGAGCAGGGCTTTGAGCCGGAGCGGACAGTAGTGGCAGCCTTTGGTTTTGACGAGGAGGCAACCAAATACCGATAT
GGCGCGGCGCGGCTGGCCGAACATCTCCGGGGGATCTACGGTGATGGTCCAGAGGGCGAAGACGCCTTTGCCATCATCGT
GGACGAGGGCGGCCTGGGAGTCAACCGGCAGTTCGGCCGGACGTTTGCGACGCCCGAGACAGGTGAAAAGGGCTATCTAG
ACATCGTGCTGGACGTGCACGTGCCGGGAGGCCACAGCAGTATTCCGCCAGCCCACACGGCCATAGGCATTTTGGCAGCA
GCAGTGACACGTCTCGAGGCCGAGGCCGAAGACAACTTTCCGTCGCGGCTGGCGGCCGAGAACCCGTTCTACTCGCTGCT
GCGCTGCGCAGCCGAGGATGAAGCGACCGTGGACATGGATCCGGCCTTGCGTGCGGCCCTGCGTGATCCCAGTGACGAAG
GACTTGCGCGAACGATTATTCTTCTGAGCGATGACGTTGAGGCGGCCAGCTTGCTGCACACGTCACAGGCCGTGACCATC
TTCCAGGCCGGTAACAAAGCAAATGCGCTGCCGGCTTATGCGAGCGCGCTGATTAACTACCGTGTCGCCGGCGAGGAGCA
GCTCGATCAGGTGATTGTGAAGCTGATCCGCACCGTCCGGCCGGTGGCCGAAGCTATGGGCGTCCGGCTGGTCTACGGGC
CCGAGAAGGGCATCGACGGCGGTGATGCTGATGACGACGACCTCCCGCAGTTCACCCTGCGGCTCTCGTGGAAGACGGCT
CTGCGGGAACCATCGCCGATTTCGCAGACGACGTCGTCCAGCTGGACATACCTCGCGGGCGTCATCAAGCACGTCTTTGA
CGAGCCCGGTTTCGGTAACAACGTCCTCGTCTCGCCCATGTATGCCGGCGGCAACACGGATACGCTCTTCTTCTGGGACC
TGAGCTCGCAGATCTACCGCTTTGGCCCCGTCCGTGCTTGGCATGACGAGGGCTGGGGGGGAGTCCACGACGTCAACGAG
AGGGTGAGTCTAGCCTTCACTTCTGTCTTGGCGCGTGCTAACTGTTCAGATTGCTCTCGATGCCCATATGGAGGCTATCT
TGTTCTACCACGAGTTCATCCGCGTTTTTGACGAGGCCGAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62