GenePrediction:GLEAN_809 Details

Name: GLEAN_809
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:141366..142495 (+ strand)
Length: 1130
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:141366..141648 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_132:141716..142145 (+ strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_132:142198..142495 (+ strand)
Length: 298
>GLEAN_809 class=GenePrediction position=GCSC_132:141366..142495 (+ strand)
ATGAGCATCACATTTGACGTTTTCCGCGCTTCGAAGGAGGGAAAAGTTGTTGCCGACAAAACGACCCGTCCTCTACGGCA
TAGCGAAGTTCACATTGAGATCACCCACTCCGGCATTTGCGGGACAGATGAGCTCTACCTGCATTCGGAGATGGTCCTGG
GACACGAGGGTGTCGGGATTGTGAAGCAGATTGGCGACAGTGTCACGTCCGTCAAAGTCGGAGACCGTGTCGGATTTGGA
TATTTCCGCAAAGTGTGCGGCTTATGCGACAACTGCTGCACAGGTAAACCTGAAATTGAAGCTACAGAGCCGATGCAGGT
GGCAATGGGTGTTCTGACTGTTTTCCGTAGGCTGGGACCAATTCTGCAGATCTGTTCGTTTTTACGGCACGAGCGACTAC
GATATCGGTACATTTGCCTACGGTACTATCTGGGATGAGAGCTGTGTCTTTCGCATTCCCGACGGCTACAGTTCCGAGGA
TGCCGCGCCCATGATGTGTGCCGGCTCCACAGTTTGGAACTGCCTCCAGCAATACGGTGCCAAGCCGGGCGATCGTGTTG
GTGTGATGGGTCTCGGTGGACTGGGTCACCTCGCCATCAAGCTGGCCGCGGCCATTGGCTGCCAGGTTGTCGTCCTTTCT
CGCACCGAGGAAAAGAGACAAGATGCCATGGAGCTTGGGGCACATGAGTTCTATGTTGTCAGCTCGTCTGAGGGAATGGA
GAATATCAAACCCTTGAAGCATCTTCTTCTCTGCGGCACCTCGGATATTGACTATGCCGCGTAAGTCAACATCAAAGACA
CGTGGCCTGTATAACGCTAACAACCCTGTCAGTTACGTGAAGATCATGGACACAAACAGCATTATCTTCCCCATATCGGT
GACATTCAAAAACCCACCGATGCCAATTCTTGCCATGAACATGAAAGGCGTTCGCCTTCAGGGTGCGCTGGTTGCATCTC
GGCAAAACCTTCGTGAACTTTTGGAGTTTGCAGCTCAACACAAAATCTCCGCTACTGTAATGAAGTACCCTTTCACGGAA
GACGGGATTGAAACTGCCATGACAGAGCTCCGAGAAGGAAAGGTTCGATACAGAGCAGTTTTGGTGAGGGATACGGGGTC
TGAAACTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62