GenePrediction:GLEAN_80 Details

Name: GLEAN_80
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:519373..522103 (+ strand)
Length: 2731
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:519373..519507 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_179:519577..521897 (+ strand)
Length: 2321
Type: CDS
Source: GLEAN
Position: GCSC_179:521968..522103 (+ strand)
Length: 136
>GLEAN_80 class=GenePrediction position=GCSC_179:519373..522103 (+ strand)
ATGCACGACCGCAAAGAGGTGCACGCCGCCCACCTGGCCGCGGGGGCCAATCGCCAGTCGGCCGCGGCAGACTGGGGCGA
CGACGGCAACCTCTGCTTCGGGGCCGGCGTCAATGTCGCCGTATGGCGGCCCACTGTGAGCCTGCGACCCGGCAGGGGAG
AGGAGAGAAAAGCAGGGGAAGAAAAGAAGAACTGACAGTGGCAGAGCGTCCCGGAACGTGGTATTCTGAGCCTGCTGAGG
GGTCATCAAGACACCGTCAAGGCGGTGCATTTTCTGTCACGCCGGCCAGGCAGCGCTGACGGCGGCCAGCATCTGGTCAG
CGGTGGGGACGATTGTGCCCTGAAGCTGTGGGCCGTCGGCGGCGCAGACGGGTCTGCCGCGTGCGTCCAGACGGTGGAGG
CTGCACACGCAGCGGCCATCAACTGTCTGGCAGCGCCACGGGCCAGCCGGCCACGACTGCAGCTTCTGGCCTCGGGCGCA
GCGGACGCGTCGATTAAGATCTGGGGACTGCGAGGTGGCAGTGATGGCGACGACGGCACGCCGGCCCAACTCGTGCTGCT
CCAGACCATCCAGACGGCCCCGCGCTACTTTCCCCTCTGTCTCGCGCTGGAGCCTCTCGAGGATGGGGAAGCGGACAGCC
CGACATGGATGCTGGCGGCCGGCGGGACGAGCAACCGGATCCAGGTGTTTGTGGGCAGCAGCAGCGCGGAGGCCTCGATC
GACTTCCGGCTGCAGGCGACTCTGACCGGCCACGAGGGCTGGCTTCGCTCGCTCGACCTCGGCTGGGAGCGCAGTGCTGT
GGATGGCAGCCGTTCGGGCGACGTTCTTCTGGCGTCGGCCAGCCAGGATAAGTACATCCGGCTGTGGCGGATACGTCGGG
GCGACGACATGCCGACGACAGCAGCAGCAGCACCAGCAGCCGATCCGCTCAGCAGCCTCCTCCTGCCCAGCAGCACGGCC
TCGCCGGCGGGCAAGGCCCATAGGATGCAGGCAGCAGCGACAGCCGGCGGTGCCGTCTATTCGGTCACGTTCGAGGCGCT
GCTGCTCGGCCACGAGGACTGGATCTACAGCGCCCGATGGGACCGGGTCAAGACGCAAGACCAAAACGGTCACGGCCTCC
GTTTGCTGTCCGCGTCAGCCGACAACTCGCTGGCCGTCTGGGAAGCCGACACGGCCTCGGGTCTCTGGCTCACCACCGCG
CGGCTCGGCGAGCTGAGCAAGGAAAAAGGCGCGACCACGGCGACGGGCAGCGTCGGTGGCTTCTGGACCGCGCTCTGGTC
GCCGTCGGGTCGCTCGGTCGCCACGCTCTGCCGCACCGGCAGCTGGCGGCGCTGGCAATACGATGCAGTCCAGGACCGCT
GGCAGCAGGCCGTGGGCATCTCGGGCCACATTGCCGCCGTCACGGGCATCGCCTGGTCGCGCGATGGTGCCTACCTGCTG
TCGACGGGCAGCGATCAGACCACACGGCTGCATACCGCATGGCGGAGGGTGGTAGAGGGGGCGGACACGAAAGAAGAAGG
CCTGTCCTGGCATGAAATGGCCCGGCCTCAGATCCATGGCTACGACCTCAACTGTATCGACGCCCTGGGCACGTCGCAGT
TCGTCTCGGGCGCCGACGAGAAGCTCATGCGCGTTTTCCACGAGCCCAAGACCGTTGCCCGGCTGCTGGCTCAGCTGACG
AAGACGGCGGCCGATGATGCGACCACGAAGACGGCCAGCACAGCCTCCATCGACGCCCTGCCCGATGCCGCCAACATGCC
CGTCCTCGGGCTGTCGAACAAGGCGATCGACGCGACGGATGCAGACGTCGTCACGGAAGAGACCGACAGCAACAGCCACC
CCCCCTTTGAAGACATACTCTCGCGCAACACGCTCTGGCCCGAGACCGAGAAGCTGTACGGACACGGCTACGAGATCAGC
TGTCTGGCCGTCAGCCACGACGGCTGCTTCGTCGCCAGCGCCTGTCGTGCCAGCTCGCTCAACCACGCTGTCCTCCGCCT
GTTTGAGACCCGCCACTGGACCGAGGTCAAGCCGCCACTGGCCGTCCACACCCTGACTGCCACGCGCCTCCGCTTCAGCG
CTGACGACCGCTTCCTGCTCAGCGTCGGCCGCGATCGCCAGTGGGCCGTCTTTGAACGGCAGGCCGGCGAGCCTGGCGAG
GCCGACAGCACGCTTCCCGTCAGCTATGCTTTGCGCGAGGCCAACGCCAAGGCACACGCGCGCATGCTGCTCGACTGCGC
CTGGGCGCCGGCCGGACAGAAGAAGCGCGTCTTCGCAACGGCCGGCCGCGACAAGAACGCAAAGATCTGGGCGGCAGCAG
AAGACGGCAGCCAGAAGGAGTCCTTTGCGCTGGCCGCAACGATCCCCCAGGAACACCCCGTCACCGCCCTCGACTTCCTG
TGGCGACCATCCGCAGAAGCCGCCGGCCTGGTCTTGGCCGTAGGCACAGAGGCCGGCAGGCTGTCCGTCTTCTGGCTACA
CCCCGAAAGCCTGGCCGTCTCGGCAGCCCTGGCACTGGACGCTGAGTAAGCAATTTTGATTTGGTTCGCGTCTCTCCGTA
CAATTGCTTACTAATGCTTCTTACCTTTCCTGCAGTCTTTGTCTTCCAAGAGCAGTGCTGCAGCTGGCCTGGAGACCCGC
TCGAGACGACAGCGCAGAAGAGGCCAATGCAGCCCAGCTGGCCATTGCCGGCGACGACTCGTCGCTGCGTGTGTACCAGA
TCCAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62