GenePrediction:GLEAN_8100 Details

Name: GLEAN_8100
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1076289..1071775 (- strand)
Length: 4515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1076289..1076230 (- strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_113:1076147..1076138 (- strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_113:1075758..1074712 (- strand)
Length: 1047
Type: CDS
Source: GLEAN
Position: GCSC_113:1074561..1074376 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_113:1073690..1073244 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_113:1073177..1072999 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_113:1072941..1072828 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:1072736..1072601 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:1072088..1072018 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_113:1071783..1071775 (- strand)
Length: 9
>GLEAN_8100 class=GenePrediction position=GCSC_113:1076289..1071775 (- strand)
ATGGAGGAGGAAGCCTCGAACGTTTGCTCCAAAGTCAAGGCTGGGCTGCAAGACCTGCAAGTGAGTGTCGACTTCGTGTA
TTGCTACATGGCGGCCAGTCGTGTTCGACTTGAAATCTGACACGCAACCTCGTTCCTCTTAGGATAAGAAGAGTAAAATG
CGATCTGTCTCGGCCTTCGTGCCTGAAATGCCAGTCCACAGGTCGCACCTGTGACGGCTATAGTGAAAAACCCCTCGATC
TAAAGCCTAGAGTTGAATCGAGTCGCAATCACATCGAGAGGGTCAACGAAGCAGGTAGCCGCGACAGTGACTACCCTTGC
ACGATGATTAGTGCATATCAGCCAAATCAAGGGCACGTGAAAGACCACGGGGTCATTCTAAAGAATCTCAGACCCTTTAT
GGTCTTACCAGTAATTGGCCCAGTCCAGAGCGAGGCCATGCGTGCTTTTGAGCATATTTCGATCAAGCAAATAAACGAAT
ACCACCCCTGCGAATCATGGCGGAATACTCTCATGTTCTTCTCTCAAACAGTGCCATCGGTGCGATATGCTGCCATTGCT
CAAGGATTGATCTACCGAAATTACGTCGATGCCGACTCTAGCAACCGTGCGCATCAACTGCAACTCTCGAAAGACTGGCT
ACCAGATAAGGCTCCCTTGTTTCACTATAATCGTGCCATCCAACTTCTTCTGAACCAGGAAAATGGCGACAATACCGAAA
CCATCGCGATCACCCTTCTGGTCTGCTATCTCTTTACCTGCTTTGATCATCTCGCGGGCAATCATGTACGAGCATTGAAA
CACCTACAGGGTGGCGTGGAGCTCTCACGCAACGCCGACATCGATGCCAGGCCCTCAGCAGTTCGCACGCTTATCTACCA
GGTCTCAAGCCAGATTCGCCGTCTCGACATGCAGGCTGAAACATTTCTGGTGGACTGGACTCCTGCCGATATTCAAGAGA
TACTTGCGTCCCAGCTTCCATCCTCTGTCAGTATCTTTCAGTCCGTCGACCAAGCTGCCGACCACCTCCAGATCCTCGTC
GCTCGGGTAATGAGGCTGCACAACTCGCAGCAGCAATTGTCCACGAGGGGTGATATGTCGTTGTCCTCATCATTCAAGGT
TATCCTTCTCGAGCAGTTGGAAACGTGGCTCAGTCTTTTCGAAAACATGCTGCCACAAGGCAGCTCCTGTGACACAAGTG
TCGAAACGTACCCGCTCATATCATTACTAAGGTTGCAACATACAATCGCATGGACTCTCCTAGCTAGTTATGGACCTGGT
GGGGAAATGTGCTATGACAGCTTCCTACCCCAATTCCAGCGATGCGTGGCCTTGGCGGGCGACATAGCGGCAGCGCATGA
GCGGTACTCTGGGTCAATTAAACCGACTTTTACGCCGGAGATAGGAATTGCCCCTGTGCTTTATATAATCGGTGTCAAAT
GCAGGCAACGCCTGGTCCGCCGCGAAGCCTTGAGTATTTTGCAACGGCGAGCAATACGGGAAGCGGTTTGGGATAGCACC
GTTGCTGCCAAAGTGGTTGAGCGGGTGATCGAGATCGAAGAGGGTGGAATTGCCCCGAGTATGGAACAGATTGCTGAGTG
GCAGAGGATCAATGATTTGTCTTGGGAACATGTCGTTAGTGGACAGTCTGCGGCCAGGGTGGATATTAGGTATACATTCT
GTGCATGGGAGAGATTGCATATCGAGTCTCTTGTAGTATAACAACTAGCCGGTGGTGGTATCGGCGGTCTGATGGTGGCC
GTTGCACGTAACATTCTCGTCCTGATCCAAGTGTATGAACGGACATGTACCTTCAAGGAGAGCGGCACCAGCAATTGTGC
AGGCCATTACCAGCCACCGCAAATGTTGAAGGCGTTTTCTCAGAGGGGTCTAAGGCTAAGGGGCAGGCGTGGCAGTATGT
TTGAAAGAAAAAAAACATTCTTTTCTGCTTTACTAAAGTGATTAAGAAGTAGATAAAACTTGTGGTTGGGCTTGGCTTCA
ACAATCCCAGACAAGTTGCAAATTTGATTACTAGCATCAAGAAGTGTAGTCTCATGCTTCTAGAGAATTAGTGGAAAATA
GTCATCAGTCTTCATTCGGCAACGTTTGGTTGTACTTTGCAGAAGTCCGGCTAGTGAAAAGCTTCCTAATTTGGCCAAAT
AACACAGTTGGTTCTTTTCCCAGGGCTATAGCATGCACAAACAAAAAGTAGCAACCGAATTGCAGACCGTGTAAACGGGT
TGATGTTACTTTCTGCGGTCTGAAATGTGTATCACATCGCATATGCAGTTTTTGTGACGCATAACTTTTAGCGCATGCTT
GCTGAGTTTGGCCAAAGCTGCGCAGCTAACACACGGTAACCAAGGGACTAAAAGTCGGTGAAAACCATGAGACTGAAACA
TTGAGTGGAAAAAATGACATCTAGAAAGAAGGTTGGAGACGTTGAGAAAGGGAGTAAAAGTGCAATATAAATAGCAGTTC
TTTTCCGTACTAAGTGCGACTGAATCATTACTTGGATTCTTTTTCTTCCAAATTCTGAAATTTAGGTCCTGATATCAACT
CAAAGATACGAATCAGTATGGCTACCGCAACTGATCCAGAATCAATGCCTTCGGCCAAAGATGGTTTGAAGACCAACGTC
TCACTGGAAAGCTTGCAAACAGATGAGCAACGCCGTATTCTCGATACTGTCTCCAAAGTGCGAAAGTGTGGACTGGACCG
TGTCCTATCCTTGCCACAGATCGTTGTCTGTGGCGATCAGTCTTCCGGCAAAAGCTCTCTTCTCGAGGCTCTAACAGAGA
TACCATTTCCACGAAATGATAATCTCTGCACTCGATTTGCAACAGAGATCAGCCTCCGCCGTGAACCTAACAGCAGCCTT
ACGATACGCATCATCCCGGACAGTAATAGGTCACTGACTCAACAGAATGCGATGCGGAAATTCTCCGAGACAATTACCAA
TTTCGAAGACATGCCAGACATCATGGGCAAGGCTATGAATGCCATGGGAATCTCCAGTATGGACAACACAGGCAGCGCAT
TTGCACGTGACACTCTGAGCATCGATATCTTGGGGCCCGACTAGCCCCATCTTACCCTCGTAGACATTCCAGGTCTGATC
CAGGCGTCTACAAAGGGAGTGTCTGAAGCCGATGTTGCAATGGTTGCAGAAATCACGGACTCCTATATCAAACAGCCCCG
TACAATTTGCCTTGCTGTAGTGTCTGCTACCAACGACGCCGCAAACCAGCCCATCCTCCAGCGAGTCCGCAAGTTTGACC
CTCAAGGAGAGGTAAGCGGCCCCCCAGTTCTTACTACCAAGGGAACGAGCTCTAAACTGATTTTGCAGCGGACGCTGGGT
GTCATTACGAAACCAGACCGGCTGAGCGCCGGATCCGGCTCTGAAACCAAGTTCCTAGAGCTTGCACGCAACGGAGACGT
TTTTTTCAAGCTCGGCTGGCACGTAATAAAAAATCGAAAGTTCGAAGAGAGCGAGTACTCTGTCCAGGAGCGAACCCTGT
CGGAGCGAACATTCTTCAGTACGCCTGCCAAAGGATGATGTGGGGATTGATGCACTGCGCGTCAAGCTTAGTCATCTGCT
CGTTGGCCACTCGAAAAAGGAGCTCCCTCGCCTCCAAGAAGACCTGGATCTTTCCCTGAGTTCTGCCTACGAGGAACTCA
AGATTTTGGGTGAGTCACGAACGACAGCAGCAGAATGCCGTGTCTTCTTAGCCCGGTTTATTATGGAGTGCTATGAAATT
TGCAAGGCCGGCATCTCTGGAAATTATGAGCATGATTACTTTAAGGCGGGAATACGGGCAGAATTCTCGCTAGGATCCAA
GACTGCTATAGCGCACCGACCTTAAGTCTAGAATATGGCAAGGATTTTGCTCCAAAGGCAATCAACCAAAATACTAACTT
GCGTAGGTCTTTATTGATCCACGATACGATGAAGGCACGTCGACAGGCGGCTTTGCACGAGCTGGACAATCTTTCCCGAG
ATCGTAAAGATTTTCCAATCAACTACAATCACTACTACACAACGACGATCTATAAAAACCGCTGCGATAGAATAAAAGTC
TAAATTGGGGAGCATATACGCAGCGATCATGCTCCAACTTCGAAGTGCAACTATGGGAGTCATTACCCGCCAATTGACCT
AAAACGGGAGTTATACAGTGCTATGGATAAATGTGCAGCAGACACTGACACTTCCAACATGGACGACTTTAGTTGCGAGG
AGGCCCTGGATGGCCTACTCGCCATCTACAAGGTTAGTGCCATTTTTCATCTAATTTCGATTTGTAACGCCTCATTAACG
GTACCAAATAGGTCCAACAAAAAACCTTCATCGCCAATGTCACAACCCAAGTCATAGAGCGGCATATAGTCCGCAATCTG
CATGACATATTCTCTCCATTGGTTGTCGTCTGCCTACCTGACAGCAAAATTGAAAATGTCGTTTCGGAGTCGAGGGCAAC
TAAGACACAGCGGGCCTTCCTTACAGACCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62