GenePrediction:GLEAN_8101 Details

Name: GLEAN_8101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1065570..1063104 (- strand)
Length: 2467
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1065570..1065359 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_113:1065296..1064977 (- strand)
Length: 320
Type: CDS
Source: GLEAN
Position: GCSC_113:1064912..1063379 (- strand)
Length: 1534
Type: CDS
Source: GLEAN
Position: GCSC_113:1063314..1063104 (- strand)
Length: 211
>GLEAN_8101 class=GenePrediction position=GCSC_113:1065570..1063104 (- strand)
ATGCAAAAGTCGGCCATGAAGGCCGATGTTGATGCTGCCGCCCAAAAGGTAGAACCATCAACGGCCTCGAAGCCCGTTTC
TATCCAAGACGGCCTTGTCGAGAAACCAGGAGAGCCCACCAGCCGCGAAGACGAGGAGTGGACAGATCCATGCTTGAAAA
ATTATGCGGCACCGCTTGTGGCAAAGGTGGTCTCGCTTCACAACGACCCAACGTGAGTTTCCATCACCACCGTGCGAAAC
CTGCCGCAACAGTAGACTAATCGGCTTTCCATAGTGAGCCCATTTTGACCTTTCGCTTCTGGGTCCTGGCCGGCTTCTGG
GTCAGCGTAGGCTGCATCATCTCGACATTTTATTACTTCAAGCCGTACAGCACCACCCTATCGACTGTCACAGTGCAGCT
CCTCTCGTGGTGGACCGGTATGCTGATGGCAAAATGGTTGCCCACGACAAAATACAAGACACTTGGCTACGAATGGAGCT
TAAATCCAGGACCGTGGAACGCTAAGGAGCATGCTCTCATTGTTGTGGCTGTCTGGGGTAGTCAGCACACGGCGTACGGT
CTCGGTCCGCTGACTGCCCTTGAACTCTACTATGGTAAGTAGCTGTCCCCCGTTATTGTCCACCAGCTGTCGTGCTGTGC
TATTGTTAACCAAAAAAGGCCAAAGGATCGGTGCTGGGTGGTCCATCATGTTCCTGATATCGTCGCAACTGGTTGGATAC
GGCTTTGTCGGGCTTTTCCGAGACATCGTCGTCCGCCCACCAAAGATGTTCTACCCTGTCGTCCTTCCCAATGTGGCGTT
GCTAAATGCAATGCACAACGACCCTGCGTCAACTGCCAGATCTCTGCGCTACTTCGCCATAGTCGCCAGTGCTGTATTTT
GCTATCAATGGTTCCCATCTCTGATATGGCCAATGCTAGGGTCCCTACCACTGCTTTGCTACATGGGTCATGGAAACTGG
ATCGCCTACATTCTCGGCTCTGGCAATAACGGCTTCGGCATGCTAGACTTCTCACTCGATTGGAACTACATCAATTTCTT
TTCACCTCTCTATACACCGCTATGGTCCACGGCAACTCAGGTTGCTGGTGCGGTATTTTGCTGCTGGTTCCTGTTCCCCA
TACTCTATTTTTCCAACACACTTGACAGCAAAAACTTTCCCGCCATGTCGTCATCGACTTTTGACTCCACTGGAACCAAG
TACAACGTCTCCCGCGTTTTGACCGCTTCTGGACATGGAAACTATACTGCTATGGCTGAATATTCCGAGCCTTACTGGTC
AACATCATATGCAATGACGTTCTTCTGGGGCTTTGCGTCGTCAGCGGGTGCGATCGCATTTGCCGTTTTATGGTACGGAA
AAGACGGCTGGGAGGCTGTCCGAGACACTCTACGTCATGGTCGGACCTCGAACGAGGATGACCCGTACCTAAAGCTTATG
GCAAACCACCCCCGGGTTCCCCATTGGTGGTATCTGGTCATCCTCGTCATCGCTGGTGGCCTTTCCATCGGCTCACTCTA
TGGCGGGCATTGGGGACTTCCATGGTGGGGCTTTATCGTGATTACAATTGTGTCCCTGTTGTTTACCTTCCCGAGTGGAA
TTTTGTTCGGAATTGCGAACATTCAAGTTGGAATGGCTTACTTTAGCGAACTTATTGCTGGTGCGCTCTTCCACGGCAAT
CCCAAGGCTGTCTTGGCGACATTGGTGTTTGGCCGCCAGGTCCTAGATCAAACACTTAACCTTTGCTCTGATTACAAGTT
TGGGTTTTACATGAAGATTCCAGAAAAAGAGCTGTTTATAGCTCAGGTTTACGGAACTCTGCTGGGACCCTTTATAAATT
ACGGGATTGCCCGAGCCATTATCAACGACATTGGTGTCGAGACATTGACTGGAGTCAAGTCTAGCTCGTCTTGGTTGGCT
CTGAAGAGCCGGAATTTTTACTCCACGTCCGTCATTTGGGGCGTCCTTGGACCAAAGGCGTTTTTCAGCAAGGGGTCGAA
CTACCACTACATTTACTATGCCTTCCTTGTGGGACCGGCTGCCGTTTTGTTCGCGTACATGATCCACAGGCAAAAACCGC
ACTGGAACATTGAGCAGTACTTCAACCCTGTGGTCTTCATGTTTGGAGGGACCTATTTCCCTATTTATGGAACGACTAAT
CTCATGACTTCTGCTATCGTAGCCTTTGTTTTGTGAGTATCCCCGTGCAACGACCAAATTACTCCATTATATTTGCTAAC
TACATCGTTACTATAGCATGGGATACATATACCGGTACCATCCCGTTTGGTTTCGCAAGTACAACTATTTGACCGGTGTG
GGATTGGATTGTGGTTCACAGATCATGCAAACCATCATGGTTTTCACCATTAGTCTCACAAACACGGATTTCCCTACTTG
GTGGGGCAACAGTGATATCACTGACCGATGCTACCCACCATCCACATTGCCCCCGGCCATGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62