GenePrediction:GLEAN_8102 Details

Name: GLEAN_8102
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1059890..1059153 (- strand)
Length: 738
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1059890..1059643 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_113:1059597..1059153 (- strand)
Length: 445
>GLEAN_8102 class=GenePrediction position=GCSC_113:1059890..1059153 (- strand)
ATGCCCGACATCGCAGCCATCACTGCCAACCAGACTGTACCGAAGTATAGCTACAACGGCCTGAAGCGGTACCATCCCGG
AAACTCTTCACTTGTCGGCCGTTCAAGCTACTGCGACAAGTCTTGTCCCACGTCCGCCACACTGACTTGGGGCGAGACGG
ACAGCGGCGGGAAGGGTATCTTCATCACCAACGCTGCCTCGGACTGGCGTGGCTTCTACATCTACCAGAACTGCTGCGAC
GATGTCCCGTACAAGTACATCTGAATCAACGCCGGCGAGACCGAGTACGTCAGCCTGCCCAGCGACTTTGAGGGCCGTGT
CCAGCGCGGTGTTGATAGCACCATGCTTGACGGCAGCTCTCAGATCCTGGGAACGTGGTTTGAGTTTAGCTGGGACTCTA
GCGGCAACGCCTGGGGCGACGTCTCCCTCATCCGCGGCTGTGACGGCGCCGTGCTGATCTGGGACAAGGACAATGGCGAC
TCGTGGATGGGATTCACGCAGTGGATCCTCACTGGCGCTCCAACTGGTGCGTATGACATGATGAATGATGGCCAGTGGGT
GCTGGCTGCGTCCGAGAAGCTGGGCGACTCCTCTGATGTCAACACGGTGGTGCGCGACTGGTACATTGACAAGGTCGGCA
CCGACCGGGTGTATGTTGACGACTGGCACGGCAACGGTGCTGTTATGAAGTCTCCTACCGGCCGCATTGCCACGTACTGG
CCCGACGGTCGTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62