GenePrediction:GLEAN_8105 Details

Name: GLEAN_8105
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1034381..1029238 (- strand)
Length: 5144
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1034381..1034177 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_113:1034004..1033796 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_113:1033731..1033577 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_113:1033493..1033175 (- strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_113:1033107..1033064 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_113:1032202..1032151 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_113:1031919..1031766 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_113:1031694..1031454 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_113:1031378..1030688 (- strand)
Length: 691
Type: CDS
Source: GLEAN
Position: GCSC_113:1030605..1029516 (- strand)
Length: 1090
Type: CDS
Source: GLEAN
Position: GCSC_113:1029281..1029238 (- strand)
Length: 44
>GLEAN_8105 class=GenePrediction position=GCSC_113:1034381..1029238 (- strand)
ATGATAAGCCCTATCATGAGTTCCTCGTCGAAAATAGTGACGGTCGCGGCCGTTCAGGCAGCGCCTGTTTCCTTTGATCT
GGCAAGGAGCCTGGAGAAGCTGGGCAAGCTGACGGCTGAAGCGGCTGCCAAAGGAGCTGACCTTGTGGTGTTCCCGTGGG
TTAATTCGCCCACCAGCAGCACAGTTCTCGCAATTGACCTCTGGGGTTATTCTACTATCCCGTGTCCCTAGTGAAGCATT
TCTCTCCGCTTATCCCTGGAGATATTCCTTCGATGCTACCATAGGTGCTAGGGAACCTCGGGGTAAGTTTCAGTGTATTC
TAAGATCATATCTAGCCTTTTTAGTGACAAGCCATTGTTTTCCGTGATGCCCCACAGGACGAGAGTGGTACGCTAGGTAC
TGCAAATCCTCCGTCGAGGTCCCCTCCCCCGAATATGACGTCCTCGTTGAGACAGCGCGAAACTGCAATGTCCTGCTCCA
GGTTGGCATCATCGAGAAGGCCGGCGGCACACTGTACTGCACAGCGCTGTTGTTGGACAGAGACGGGTCCATGCTGTACA
AGCATCGCAAGGCAAGTTCAATGCCCGTATGCTTACTCAATGTGCCAGAGCTTGGGTCACATCTAACTTGGTGGGGGTGT
ATCTGTATAGTTAATACCAACAGCCGCTGAGCGTCTCGTCTGGGGCCGTGGAGCTGGAGATGGCCTTGCTGTCGAGGCCA
CAAGCATCGGGAAGATCGGGAGCCTCATTTGCTGGGAAAATTATATGCCTGCGGCTCGCATGGCTCTTTACCAGCAAGGC
ATCGAGTGAGTAAATCCCTCTCCAAGCCCCGATCCTGACCAAAAGGTGACAGATGCGTTTGATTAATCCCGGTCAATTTT
CATTGTAGGATATATCTGGCTCCGAACGCCGATGACCTCCCTGCTTGGACAGCGACAATGCAGCACATTGCCAAGGAGGG
CCGTTGCTTTGTCATTTCTGTGAACTCCGTCTGCCGTGTCTCCGATTTTCCCGATGACTACCCCCCTTTCACACCGGAAC
ACCACGATAGAAGACCCGATGGAGGGAAATGGGAGAAGAATGATATCGTCAACCACGGTGGTTCTTGTGTCGTGGGCCCA
CTGGGACACTTTCTTTCCGAACCACTCTGGGACAAGGAAGCAATTATTTACGCCAAGCTAGACTTGGGTGAGATCCATGA
GTCTCGGGTGAGCGAAACTTCTACTTCTTTAAACTCTTCGCTTGTATACAGATGCTGACAGCTAGTGTGCAAAGCTCGAT
TTCGATCCTGTGGGGAGTTACTCTCGGCCGGATATTTTGTGAGTAATGCCTTAAATAAGCAGAGGTGATTTTCTTGTCAT
ACTTATTAGGACACGTTCACAGCACGTTGCAAGTGAGCCAGAAGCCAGCGTCTAACGTGATCTTTACGAAGTAAATGAGA
GCCGGAAGTTTGTCTCGTTGCTGGGACTTGTGCATTTGTTAGGAAATATGCTCTTCTGAGGATTACTATGCACTGGTCTT
GCTGGTCTAAGATAGCTGCATACGCAAGTGAGGATAATAAGTTCTGATAATAGTTGTTGTGCTTTTCTAGGGAAAATGGG
ACAGAAAGTAGCGATCAAGACAATCAGGTAGAAACATGTCTCTTTAGTGCGGGATAAGCCGGCAAAGTAAGGCTCTAAGG
AGGTGGTGATAGTTTAGTTACGTGCCTGCACAAGTCTGCGCAAGCATTGCATTCAGGATGCTGACCCGCGCTGGCTGACT
AAGTTGGACTGGTAATGAAGCCCCATTTTTATCTCAACACCTTGCAGAGACGTGGGGTTTCCCGCCGGTTTTCGCCGGTT
TCTCTTACACCGCTTTAGGAAACAGACCACCTCTATGCAGCCAAGGCAGGCCAGATGGATAGCCCGGGATTTAATACTCC
GTAGTTTTCCCTTTAACACATCCTCCAGCAATCGCCCCCCACTCGCGAACTCCTGCCGTTTCCTAACCTCGCAAATCTCA
ATTGAAAGTGACAACCCTTGATCTGATACTTGCACGGGATTGCTCGTCTGGTGCTGTGAGATCCGGATGCCCATTGGAAA
GTCAGCATTAATTGATCAGAATATCCCGTACTATGAGTACGGTGCAGCTCTCGAAGATGTCAACCGCTGCTTCCACTTCG
TCTACTGATGCGCACCCAGCGGCCAGGAGGAAATTCGCCACGCCTCCGGCCAAGGTGGCGTGTCTGTCATGGTAAGCGGG
ATGGATCCCATTTCAGCGGGCCGTTGCGATCACTACTTTAGATGTTCTAGATACCCCGACCCTTTTATATCGTAATATTG
AATATCTGCTGACCCCAGGAAAACCAGCCGAGGCTCCCGGACCCGATGTGATGGGCGGCTGCCCTGCGCTAACGTGAGAT
GCAGATTGAAGGACCCCTGCATCTTGGAAGAATTTGCCTAACGCTTCTTTTTTGATCGACAGTGCCAGAACCAATGCCGC
GAGTGCGTGTACAAGCCTAGCAGGCGAGGTGGCTCTCGCGCGCGAAGAAAGGACCGTCCGCTGCCGGACGACGTCGCAGA
GCGTGCGAGACAGGTCAGGATGGCTGAGGAGAAGCAGGAGAGGGAAAGGCATGACCGTATGTGCTGTACCCAGTGTTATG
CTGCCATCACCTTGTTGATTGTAGTTGACACTGATTGCCGAGAACAGCTATCTCAGTTGCGAACTATATCGATCCCGGAG
CGGGACTCGCGCAGATCCAGGAGGACTTTTATCAAGATAGCGACCTCATCTTCGACAGTTTGTTCGCATCCGAAACAACC
TCCGTCAGAAACAACACAGCTGGACAGGACGATGTTCCGGACATGGACGCCGGGAATAGGCCGGAAACGGGACTGGAAAC
TCTACCGCAGGTTCCTATGGTCCGAACATACAGCAGCGATGCTGCCATGTAAGTGGATATGTATAACAATGTAAAAGATA
CATACAGGTAACATGACTAATCCGACGTTGAGGAACGATATAGTCTGGAGGCATACTATGTCTTCATACACGCCTACTTC
CCGATCCTGCCCCCACCGGTGGATGTGCCTGTGGACAGACCGTTGGCCCAATACCAGAACCAGATGAGAGACGATGAGTT
CGAGCCATCGTCCCCCATATCACTGGCCATCTCCGCCATTCTAGCCCTGATCCCCTGCCCTGACGACATGAATCACCAAG
ACCACGAGTCTGTTCTTTTTCGGCGTAAATACGCCCAGTATCTGGCCCAATCGGCAATCGAGAGCATCGAGATCGAGAAC
GAAATACCTCACTCATCCGTCGAGCCGGCTCAGGCGCTCGAGCAGGCAACCGAGGAGACGGCGAACGTGCACTTAGGGAT
ATCCTCTGCCACTCGGATGCCCTTTCATCCTGGCGTCCCGCTCAATCTCGAGTCGGTCATCGCTCTCGACATCCTCAGTG
TCTATGAGTATGCCCAGCGTGGTAACATCAAGAAGATGCAGAGCCGGGCCGGTCAAGCACTTGTGGCGGCGATGGCTCTG
GGTCTACATACAACGCCCGACGGGGCTGAGGCGGTCGAGGCCAAGCGAAGGGTCTGGTGGATGACGTACGTTTGTGTCTG
CCAAGGATCCATCGTGGGTAACACGAATCCGACGTTCGAAGTTTTTGCGCAGCGCTTCACAACCAAATTTCCCATCATCG
AGGCAGACCCAGAGGTGGTTTTTCTCCTTCCCACAGATTCTATATCAAAACACTGACTTGCAATTACCTTTTCAGGCATT
CACTGTCTATATACAGGCCCAACAGGCCATTCTGGCTGCGACACAGTTCGTTGTCGAGCTCAACAAGACAGTTCAGGCCG
GCGACGATATGACACGCATCTATGCGCGAATGAAGGAGTTTGAGCTCTTCCTTGAGCCTCTCAATACCAGTGCCAATCTC
TGGGACCTACCCGGCACCATCGCCTCCCCCGTTGACCCTACGGAGCAAGTCCTCACACGCTCTTTGAGATGCATGGCTCG
CATCAAGCTTAACAGCGCCCGCATCAAGGTCCACCGGTACTGTGCCTTCTATGATCATCCGGTGTTCTCTCGCAGACACT
GCGACCTCACGTCTGTGCCTTCAGAATGGACGACGGGAGCCGGTGCAAGAGTGGATGGAATCCAGCAGGAGCCAAAGCAG
TCGGACAGCTGCTCGTGCAGCTCCTCGTTCTCCTTCAACAGCATCAGCATCTCACCACCACCTCCGTTCTCTGCACTTCG
AGCTGGCACTTCTGGAATGTCCAGCATGCCCGTCTTAACCCCTTCAGACACCAGCAGATCTTCCTTTTCTTCCTCCAATA
TCCCCACCACCTCTCCATCAGCCCGTACTAACCATAATTACCCCTCGCGTTCTTTCCCTTTCAGCAGCCACCAGTCTGCT
AAGATTTGCCTCAAGTCTGCCCTCAACATCACCCAGTCCTTTGCTGGTCTGCCTTATCCGAACCCCACTGGAATTCAGCC
CCCACCCCCGACAACGCGGACCCAGCAGCAAGAAAACAGTCCCACCGGCTCAGCCAATCCAGCCAGCATTCCCAGCCAGG
TTCAGCAGTTGTGCTGTCTGTCTTCTCCGACCTGTTCGGCAACTGCCGTCGTGGCCCCACGCACGATGCCCGCATTTGCC
TGCTGTGCGATGCAGTGCGCCTACGCCCTGCTTATGGTGGTTCACAAAACCAACGCACTGTACCCAGCTGGTCTGGAGCA
GCAGCAGGGTGGTGAGACTGGCAGCGGAGACGACAATGGCCTCTTGGCTGCCAGCCTGCTTACACGTCTTCGGCAAGGGC
TGGCGTCTATTCTGGCCACCTTGGAAAATTACGGAGTGGCGTTTGAGGCTCTAGGTGGCATGCGAGGTACGCTTTCCAGA
ATCCGCTTGGCCTTCTCCACGCTGAGAACATATCCTGTCACGGCCATCTTACCTCGCGTGGGGTGTAAAGCACTCCCTGC
CGGGTGATCGCTATGATATCACGCAACTTACCACATCTTCTGGCGTCCTTATCCATGTCACTGCATTTGTCTCTGTTGGG
TGTTGCGAAAATCAAGAATGATTGGATGATGGTGAAATGCTAACACAAAGCCCTTGACAGACCAAATACGAAGCGCCGCC
GATCCGTTTCTCACACCGACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62