GenePrediction:GLEAN_8106 Details

Name: GLEAN_8106
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1028620..1026918 (- strand)
Length: 1703
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1028620..1028586 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_113:1028503..1028388 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_113:1028313..1027394 (- strand)
Length: 920
Type: CDS
Source: GLEAN
Position: GCSC_113:1027286..1026918 (- strand)
Length: 369
>GLEAN_8106 class=GenePrediction position=GCSC_113:1028620..1026918 (- strand)
ATGCCTGTCTCTGGGTCTTTGGCTAATGTGGACTGGTACGTACATTATCTGAATCTGGACTGTATAAGCAGACTTGCAGT
AGTCTTGGTCACAGCATGAATTTTTGACCAAAAATAGGGAACCCAAATTCTCTACCGTCGCAATACATGGCGGTCAAGAG
CCGGACCCGGTCAACGGATGTCGAGCTGTGCCACTGTACCAGACGGCTGCATACAACTTCACAGATGCTGCTGGTACGTG
GGAACGATGCCCTAAAATCGAATATCTCTTGTCTGTGGCGATGCTTACCTTCAACTTTCCTTTGCAGATGGTGCCAGCAA
ATTCGCTTGGAGTAAAGATGGCTACGTATACACACGGATGGGAAATCCCACCAACAACGTTTTTGAGACGCGCATGGCCA
TGCTCGAGGGTGGTGTCGGGGCTGTGGCCACAGCCTCAGGTCACGCGGCACAGTTCATGGCCCTGACGCAATGCTGTGAG
CCCGGACAGAACTTTGTCAGTACTTCGTGGCTGTACGGCGGTACGTACAACCAGTTCCGTGTGTACATGAGGAAGTTCAA
GATCGACGTGAAGTGGGTGGTGGGCAACGAGCCCGCAGACATTGATGCTGCCATCGACGAGAATACTCGCTGTGTGTACA
TCGAGACGATCAGCAACCCCAAGCACAGCGTTCCAGACATCCGCGCCATTGCCGAAGTCGCACATAAGCACGGCATTCCT
CTCATCGTGGACAACACCTTCGGCATGGGGGGATACCTGTGCAAGCCCCTCGTATTGGGTGCCGACATTGTCACACACTC
GTGCACGAAGTGGATCGGCGGTCATGGTACATCCATGGGTGGTATCGTCATCGACGGTGGTCACTTCGACTGGTCTGCAT
CTGGGAAATTTCCCAGCTTCACGGAGCCTGCGGACGGGTATCACGGCTTGCGCTTCTGGGGGACGTACAAGTTCAAAGCC
CTCTCGGCTAAGCTACGGATGGACAGCATGCGTGATCTCGGCCCCTGTATGAGCCCGTTCAACGCCTGGTTGTTCATCCA
GGGGCTCGAGACGCTCTCCCTCCGAGGACAGCGACATGTTGAGAACACACAGAAGCTGGCCGAGTGGCTCGAGGCGCACC
CTTGCGTCAACTGGGTGCTCTATCCGGGGCTTAAATCGCATACGGACTATGAGTACACCAAGAAGGTGATGGTCAACGGT
GCGGGCGGTGTCCTGACGTTCGGTGTGGTGAGTTGGCGCCCTACCACGTTGTCATCCCTCTGCCCTGGTGCTTGCCATCA
AGTCTTACCCTGTCATGCTGAAAATGATTGCTGATGTGATTGGGAACCGAAAAGGCCGGCAACATTGATCGGGTCCGCGC
CGTCGTTGATAACCTCAAGCTATGCTCTCACCTTGCAAACGTCGGCGATGCTAAAACCCTCATCATCCACCCATGGGTCA
CCACCCATCAGCAGCTTCCTGACGAGGAGAAAATCAAGGGCGGAGTCACTCCGGACCTGATCCGCGTCTCTGTTGGCATT
GAGGACTTTGAGGACATCCAGCGCGACTTTGAACAGGCATTCTCGGCGGCCGGACTCACGTCCGTGGGTGAGAAGAAAGC
AGGATCGGATCCGTTTGAGCTTGCGATGGACCTTGTATCGGGTGGCTTTATGGGCGACAAAGCGACTGGCGCGCCAAAGC
CCGAAACTGCTGGGACAGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62