GenePrediction:GLEAN_8107 Details

Name: GLEAN_8107
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1021224..1019415 (- strand)
Length: 1810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1021224..1020803 (- strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_113:1020506..1020314 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_113:1020251..1020143 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_113:1020067..1019718 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_113:1019462..1019415 (- strand)
Length: 48
>GLEAN_8107 class=GenePrediction position=GCSC_113:1021224..1019415 (- strand)
ATGCCTCCCAGAAAGCGCGCTCTCGCTGACAGCGACAGCAATGTCGGAGTTGCAACTACAAAGCCCACGAAGGTGTCGAG
AGCAGCGAATGCATCGTCGCCATCGGGCTCGCGAGCAGCTCCAGGTTCTATTGAAGCTCCGCCCACAATCCCAACATCTG
CTCCAGTCTTGGCCGCGGCTTCCGCTCCTGCTCCTGCGCCAGCGCCAGCTCCGGGTTCGCGTACGGCTCAAATCCCGATT
TCGTACCGCATCCCAATGGGACCCAATGGAGAGTTCTTCATGCCGACTGTGATGCCGAAGGAGTCCGTCGATCACATCCA
CAAGATTCCCATGCCTGACTGCTGGGTTGTGGCCATCGATGCGACACCGGATCACAGCATGACGCTAAACAGCCGCGAGT
GGTGGGAGCAGTATGGTGTGGTGTATGGGTGCTGAAGAACAAATCCAAACTAGGTATCCGAAGCCCGACTCTCTTGAAAT
ACCAACGGGATGCGATGATGCAGCCCGTCATACTCAAGGCTGACGAGGGCTACGACGACTGGGACTTTGTTTGTGTGCCC
GAGAGGAAAGTACGCAACCCGGACGGGGATGATGAGGACGAGGACGAGGACGAGGACAAGGACGACAAAGATGACGACAA
GGGCGATAAGGACGGTAAAGATGAAGACGACAACGATGACGAGGGTGGCGAGGATGCCGAGGGCGGCGAAGATGCCAGAA
ACAGGAAAAAGAACATCTCTGGCAAGCTGGCATCCCTCTATCCCGACCACCCCTGTGTCTCTTCCGTACGCGGACTGGAC
ATTTCGCGGTTTTGGATCCTCGAGACGCTGAAGCGCGACCAAGACTCCTTTCAGATGCACGTGTACAACGACTTCAGTCT
GTATGGCCAGCTCGAAGTGCTCCAAAATATTGTAAGTGGCCAGCATACTTCATTTGGTGACTGCGCTGACCAATTGTACC
TCAATAAACGTAGCTTATCCAATTCAACCAAGTATACGAACGCAACCCGAATATACAGCAGCTGTGGCCGTTGCTGGAGA
GTGTCGCTCTGTTCCTCAACAGTGGATTTATCGACTTAAGCAGTAAGGCATACGTCCCTAATAATGCCGCTTCGTTTTAT
TAGGTAGTAGACTGCTAACTCGGCTTCTTATAATCAGTGATGGATGACCCAGAGCAGGTCGGTGCAATCATTGAGATGCT
CGGCTACATGACAATGGCCACTATCGAATATATCGACAACAAGCTCGCCCCGACGCAGGACTTGAATCTTCCTAATACCG
GCTTTATTACCGCGATGCTTGTAAGCTGGGCTTGGGGTGTCGGCATAGATTTTGAGGACTGGGCCGACAAGGCGACATGG
CTTCACCGCGTCTTGCAGCGGGCTGACCGTTTGAATGTGACGCTTGTTGGGGTGCCTGGAATTGACGCGACCCTCACGGC
AATTCGGGCTGTGCAAGTGCCTGGGGCCGTTATGCGGAAGTGGACAGACGTGAGGTGGGCTACACAGGTAAGTCGCCAAA
CAAGCAAGCAAGCAAGCGACATAACACTGACAAATCAGCTGAGAGCTTTCCGTCGTATCACGGAACTGGTGATGGGAATA
TCCCGGGTGTCCACTTTGATATCACTCTGATGACAGCGGCAGAACGGCGAAGAGGGTCGTTCCGTTGAGTGTCTCTGAAC
TATTTGTGCATCGCTTGCGTGTCTGGATAGTGGGTGTTATGTTGGAAAAGCAATCAGTGCTGATTTCACTAGTATACATT
AGGATATCAGCTACGAGGGCCAGTTTCGCCGTTCACCATTCTGCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62