GenePrediction:GLEAN_8108 Details

Name: GLEAN_8108
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1013264..1011772 (- strand)
Length: 1493
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1013264..1013180 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:1013120..1011772 (- strand)
Length: 1349
>GLEAN_8108 class=GenePrediction position=GCSC_113:1013264..1011772 (- strand)
ATGGCCAGCCTGCCTGAATTCACGGCCGACGAGGTCGCTGCTCACAAGACTCAGGAGGATCTCTGGATTGCCGTCCACGG
AAGAGGTGAGCCCCCTCTGCAATTCCATCCCATCCTGTCCAGTTAGGTCTTGCTGACACATCAGTGTACAATGTGGCCTC
GTATCTGCAGGACCATCCTGGTGGTGCGGCCATCTTGCTCGACGTGGCCGGCACTGATGCCTCGCACGAATACGATGATG
CCGGCCACTCTGAGGATGCCGACGAGATCATGGCTGCCCTGGTTGTCGGCACGCTGCAGGGTACTCGTGTTGGCCGTCCA
ACCAAAACCGTGCAGCTGATCCAGTCGTCATCGTCGTCGGCCAAGACCGTGTCGTCATCGTCGTCGCTGTCTCTGCACGT
GCTTCCCGTCCTGGCCATGGCATCTGTCCCGGTTGGAGCGGCAGTCGCGGCCGTTTACCTTCCCGGTCTCTGGGGTGCAC
ACAACGTGTCCCGCCTTCTGTGCCTTCTTCCGTCGCCTTCTCACGGCAGCAGCAACCCGGCGACGACGTTTGGTGGCGGT
GTCCTCGTGGCCAGCCTGTTCTGGACCGCTCTCGTCGGTGTTGCTGGCAGCCGGCTGTCGGCGCGGTTTCTGCACATCGA
CAGTGGCTTCACACGCTTTCCCATCCAGATCCGGACGCAGACAACCACGTCCAGACGCGTTGCCCGGCCACGACCGCTGC
TGCAGGCGGCCGGCTTCCTCGACCCGAAGACGTACAAGACGCTGCCGCTGGTGGCCAAGACAGAGCTCGCGCCCGGCGTC
TTCCGGCTCGAGTTCCGACTGCCACAGCCGACCGACGTTCTCGGGCTGCCAGTCGGCCAGCATGTCGCCATCCAGGCCAC
CATCGACGGCCAGACAGTCGCACGCTCGTACACGCCGACATCCAACAACGCTGACCGCGGCCGGCTCGAGCTGCTCGTGC
GCTGCTACCCCGACGGCCTCCTGACTGGCCGCTATCTCGCCCTCCTGCAGGTTGGCGACACCGTCCGCTTTCGCGGCCCC
AAGGGCGCCATGCGCTACAACAATCCTGGCGGCCGGCTCTGTCGTCGCATCGGCATGATTGCCGGCGGTACTGGCATCAC
GCCCATGTTCCAGCTCATCCGCGCCATCTGCGACGACAGCCACGACCAGACCGAGGTTTCGCTTATCTATGCCAACCGCT
CCGAGCCCGACATGTTGCTGCGTCGCGAGCTCGACGCTTTTGCCCGCCAGTATCCCCGCAACCTCAAGGTCTGGTACATG
CTTGACCACCCTCCCGCTGACTGGCCGTATGGCTCTGGTTTCGTCACCGCCGATGTCATGCGCGAGAGGCTGCCCAAGCC
CGCCCCCGATACCAAGATCATGCTCTGTGGGCCTCCTGGCATGATCAACGCCTCCAAAGCGGCTTTGCAGTCGCTCGGCT
TCCAGACCCCTGGACCCGTTTCGCGTATGACCGACCAGGTCTTTTGCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62