GenePrediction:GLEAN_8109 Details

Name: GLEAN_8109
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1011413..1009006 (- strand)
Length: 2408
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1011413..1011326 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_113:1011254..1010905 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_113:1010836..1010452 (- strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_113:1010400..1009988 (- strand)
Length: 413
Type: CDS
Source: GLEAN
Position: GCSC_113:1009887..1009006 (- strand)
Length: 882
>GLEAN_8109 class=GenePrediction position=GCSC_113:1011413..1009006 (- strand)
ATGAGGCGTCCTATCAGCAGCAACCTCTCGGGATTTACCGACACGGGACCCATCGAGAATGTATGCTTGCTCGCCTCTGC
GCTTTCGCGTCTCTGGTGGCCCACTGAACCATTTCTATAGTCGTGAAAGCCTTGTACCGACCACTCGCTTTGGGCACAGT
CAAACCGCGCGGATGGATCCGGGACCAGCTGCAGCTCGAGGCTGACGGCCTGGCCGGCCGCATGTTGGACTTTTACCGCT
TCGTAAACGACTCGCAGTGGCTTGGCGGCAGTTCCGAGTATTCCGTGTTGAACGAGGCGTCTCCGTACTGGTTCAATGGG
CTCGTGCCATTGGCCTTCAGCCTGGAGGACGACGACGGCAATACAGCTGCGGCTCGGATCCGCACTCAGGTTCGCCAGTA
CCTCGACTACGTGCTCGACCACCAGCAGCCCGACGGCTGGCTCGGCTTCGAGACCACGCACCAGACCCGTGGTCTCTGGG
CCCGCTGCCTGCTGCTGCTGGGGCTAATGGTAGGACAGGACATGACACGTCTGGCGCGATCGATCGCCGACACAACTGCT
GACACGGACACAAACAGCAATACGCAGACGCCGATCCGGCACAGACAGACCGTATCGTCGAGGCCATGCATCGCTACGTC
GTTCTGGCCCACAGCATGTTGCAGGACAACTATACCGGCCTGATCGTGCACGACGACGACGTCTTTGACACGGCCGGCTT
CGGCGTCGCCCGCACGCACGAGATGCACATCCCGCTGCAGTGGCTATACGAGCAGCACTCCCACGATCACCAGCAGCAGC
AGCGCCTGTGGGAGACCATGGAGCTCATGGTGGCTGGCGGCGAGCTCTGGGGCGCCGACTGGCGCCAGTTCTGGGTCGAA
ACCGCCTTTCCAGCCGTGCTGGACAACGACAGCCCCTATAATCTCAGCTGGGTCTTTACCCACGGCGTGAACATGGCTCA
GGGTGCGTCTGTGCCATCTCAGTCCCGTTTGCTGTTGCCCCACTGACCTCCAGGCCTTCGATATCCTCTGTCCATATATC
GCATGACCGGAGACGAGGCCCTGAAAGAGCAGACTCGCACGGCTCTCAACCTGCTAAGCCGCTACCATCGATCACTGGCC
GGCTCCATCGTGGCCGACGAGATCATCACGAATCTGAACCCCAGCCACGGGGCCGAGCTGTGCACGGCCGCCGAGATGAT
GTTCTCGACCGCTTGGATCTACCAGCAGATGGGCGACAACGACGTGGCCGACTGGGCCGAGCAGGCTGCCTTCAACGCAC
TCCCGGCTTCCATCTCACCCGATTGGTGGTCGCACCAGTATGTCCAGCAGGAGAACCAGCCCTGGGCGAGAAACCTGACC
GAAGGCGCGGGTCTGTGGACCGATGTCAACACATATGGTAACGTGTTTGGCCTGGAGCCTGATTATGTGAGTGTTAGGGT
GACGAGAACGGAAGGGAAATAAAAAGAAAAGAAAGAAAAGAAAGAAAAGAAAGCAGAAAGACAAAACTAACCTTCCTTAC
TCACAGCCCTGCTGCACCGTCAACCATCCGCAAGCATACCCCAAGTTCCTCGCCAATGCCTTTGTGCGCACGCAGGACGG
TGGCCTCGCCCACGTCTTCCTGGTCGCCGCGCTCGTCAACACCACCCTCGATGACGGCACCCACGTCTCCGTCCGCGTCG
ACACGCACTATCCTTTTGCACTGGACCTGACGTACACTGTGACAGCTTCGGCGCCCTTTTTTCTCTACGTTCGCATCCCG
ACCTGGGCCGATGCATCGAAGAGCACTGTCCGGATACAACACCGAAGATGGGGAACTGATGGCCACAAGACTGAGACGAT
ACAAAGTCTCTTCTCACCCTACCCAGGCCTCCACCGACTGTCTGTTCCGGGAGGTAGTGGTACCGCTGTCTTCACCGTCG
AGCTCGCCACGCAGCTGCGCATCGTCCGTCGCGCAAACCACACCGCCGCCCTCTACTACGGTCCGCTGCTCTATAGCCTC
GCCATCGACCACACCACCACCTCCGGACCGCCCCGTCACTATCGCCATGCAGACCAGCTGCTTCCTGGATCCACCGTTCA
CGACCACACGCACGACCACGTGCTAGAGCCGACGAGTTCGTGGAGCATCGCCATCGACCCGTCGCAGGTTCGTGTCATCC
AGCATCCGGTGGCCGGCGACTTGGCCAACCCCGTCTGGACGCTCGGCGCTCCGCCCGTTGAGCTGTGCGTCGCTGCCGTC
GAGATCGAATGGCCGCTCGAATACGACTCACCCGCTGCACCGCCCACAATCCCGGAACCGGTGGCCGGCGCTGTGCCGTT
CAGTGCGCGCTTCGTGCCCTACGGGAGCGCCAAGCTGCACATGGCCGACTTTCCAGTGATGGTACTGCCGAAAATCGAGT
TGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62