GenePrediction:GLEAN_8111 Details

Name: GLEAN_8111
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:993299..992023 (- strand)
Length: 1277
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:993299..993246 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:993177..992023 (- strand)
Length: 1155
>GLEAN_8111 class=GenePrediction position=GCSC_113:993299..992023 (- strand)
ATGGGTAGTGCATCGGCCCCAAGGGGCGACGAAGAAGACCTAGACAAGCTAATCGTATGCGCCTGCTCCTGCATAATTCG
GCATCCACCATGAAGGTGTACATCCTACTAACTTGTCCAAAGACAGAATTTGGGTCCTTGGTGGATGAGTCCCTTGTCGT
ACTCATATTTCGAGAGCAGGGCTACCAGGAAACACGCAAAGCGCTCGCCGAGATATCTAAAGATGTGCGCGACGAAGAAG
CTTCCGGCTTTGACACCGGCAACTACTATGGCTCCGAAGGTGGTTCGAATATAGAAGGCGCACAGTCCCCTTCTCTAACC
AATAGCGGTTCATGGGCTACGTCCGACTACGATATTGGCTCTCCGCGCACTGCTGCGTCGGCCATGGCGGATGACTTTCA
GCCGTTAGCAAGAGATCAACTTCTCCCAGACACAGCCGACGCTGGAGCGACTCCAGAAGCGACCCTCAAGAGCATCTTCC
CCATGCTGAAGGACACGGATATCAGAAGAGCCCTAAAGGAGTCGGCGGGCGATGCCATGAGGGCGTCAGACATTCTCCTG
AACATCAAGCATCTGGAGGAGACGGGCCAGCGGCTAAAGGGAATCGACGCTTTCTTTCAGCTGGATGGATTTCCAGCCAA
GAAAAGCCGGAAGAAGGCACATACAAAGGAGAAGGAGACTGGGCGACAACGGCTGTCGGTGGACTACAAGCTTGCGCCCC
TGAGTGTCAACGAACAAGCTGAGTGTGCTGAGCGCTCGTCGACACAATCAGCCCCTCCCCAGGTGTCTATGACGCCTGGC
AACTGTGTCGACCAGGCGGCGATGGCCGAGAAATCGTGGGCTGCAGCCGGTGCTTCTTATGCGGCTGCATCGGCAGCAAC
TCGTCGAGGTCGTTCAGACCCTCTTTTCCGTCAGGTGGCTGCAGTGTACTCTGATCGCGGTCGCGAACAGGCAGCCGTGG
CGCGGCTGCGGCAGAGCGCGGCCGCCGACGCCTTTGTCGAGGAACAGAGCTCTGCAGACGTCATCGATGTCCATTACGTC
ACTGTCGACGACGGTGTTCGCATCGCCGTTGAACGCACGCAGCAGTGGTGGGTTAAGCTCGGCGAGCATCGGATAAAGAA
GGCTCGGAACGAGCCTCTGCGCGTCGTGACTGGCTCTGGAGTGCATAGCGCCAAAGGTTTCTCCCGTATGTATGGAGAAG
TCGGAGCGGCGCTTGAGAGGGCTGGTTGGAAGGTCCAGCCCGGAATCGGCCATTATCTCGTTACTGGAAAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62