GenePrediction:GLEAN_8112 Details

Name: GLEAN_8112
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:991393..987409 (- strand)
Length: 3985
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:991393..991109 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_113:991011..987409 (- strand)
Length: 3603
>GLEAN_8112 class=GenePrediction position=GCSC_113:991393..987409 (- strand)
ATGGCGCGGCTATCCCGTTTCATTACGGCCGGTGGCAGCGCTGTGCTTCTCGTGCTGGCCGGTCTCGACCAAGTGGCAGC
TGAAGAAACAAAATACACACCGAAGCATGAAGCCGGCCGATGTGCGATCCGCGGTCAGTGCGGAAAGCAAAGTCTGTTCA
GCCCGGAACTTCCCTGTGTCGACAATGGTCTTGCCGAGGAGCCGGATGCAGCTCTGAGGCAGCAACTGGTTGGCTTGTGC
GGAGCGAAATGGAGCACCGGCCCCATTTGCTGCACCGATGTTCAGGTACGCTATGCTCATCTCTGAAAGAAAGATTTCTC
ATTCCCCATCTATGCGGCTCGTCCTACTCGGGTTTCGTTATCTAACTGGCATGTTCTTCTAGGTCGCCGCATTGAAAGAC
AACCTCGGTACCGTCAACCAGCTCATTTCGTCGTGTCCAGCTTGCAAGGATAACTTTTACAACCTCTTCTGCACCTTCAC
ATGCTCGCCCGACCAATCTCTCTTTATCAATGTCACCAATGCGGCCAAGAAAAACGATAAAGTATTGGTTACAGAGCTTG
ACCAGCTTGTATCGGAAGAGTACGGCACCGGCTTCTACGATAGCTGCAAGGAGGTCAAATTCGGACCAACAAACTCTAAA
GCTATGGACCTGATTGGGGGCGGAGCAAAAGATTACCACGAACTACTGGCGTTTTTGGGCAAGAAGAGGCTCGGCGGCTC
GCCGTTCCAGATGAATTTCCCTGCCGAGTACGAAGAGCCAGAAATGAAACCCCGCCAAATGACACCGAAGAAATGCAACG
ACGAGGACCCTAGCTTCCGCTGCGCCTGCACAGATTGTCCCAGTGTCTGCCCTGCTCTTCCAGAGGTTAAGAATGCTAGT
TCTTGCCATGTCGGCCTCTTGCCATGCCTGTCCTTCTCTTCAATTCTCGTCTACTCTGTCTTCGTTGCGGTGCTACTTGC
TTGGATCGCACTGCGCTTCTGGTACACAAATGGCGGAACCAAAGCGTTGCCACTTCTTCACGATCCCCGCAGCGGTCATG
ATGAGGACGATGACGTAGAAGACGATGACCGGCGCGCTTTCCTCTACCAGATCATTCACGGAAGTGGCACCACTGGCGCA
GATATCGAAGAACCGCCCCAGAGCTACAAGCTGAACACAATGTGCAACGCGGTGTTCAGGAGGCTTGGCCACTGGGCAGC
AAGATTCCCTGGAACCAGCATCGGCGCCAGTCTATTGGTAGCCACGGTCCTGAGCTTGGGCTGGCTTCGATTTGAGCTGG
AGTTGGTCCCAGAGAAGCTTTGGGTAAGCCCTTCATCAGCGGCTGCACAAGAAAAAGCCTTTTTCGACACCAACTTCGGG
CCTTTTTACCGTGCCGAGAAGATTTTCCTTGTCAATGACACGCTCCCAACTGGTCCCGGTCCGGTTTTGAGCTACGACGC
TCTATTCTGGTGGATGAATGTGGAGAAGAGCATTGAGAAAATTAAGGGATCCGAATTCGGCATGACCTTTGACGATGTAT
GCTTCAAGCCTACAGGAAAGGCCTGTGTGTTGCAGTCTGTGTCTGCTTACTTTGGTAGCGACACTGCACTCCTGGATAAG
TACTGGAAAGAGACCCTGACGGCTTGTGCGAAAAGCCCTGTTGAGTGTCGCCCAGAATACGGGCAGCCTTTGGACCCCGA
AGCCATCTTTGGGGGCTTCTCCGATGTCGAACATGTAGCAGATGCACCAGCAATCACCGTCACCTGGGTTGTGAACAACT
ACGAAGAAGGCACCCCGGAGGTCAAGCTGGCTATGGACTGGGAGCGAGCATTGAAGAACAAATTGCTTGAGGTGCAAGAA
GAAGCAACATCCAGGGGCCTCCGCCTCTCTTTTTCCACCGAAATCAGCCTAGAGGAGGAGCTCAACAAGTCCACTAATAC
TGACGCCAAGATTGTAGCCATCAGCTACATTATTATGTTCCTGTACGCGTCTCTGGCACTAGGCTCGACAACGCTCTCAT
TCAGCGACCTGTTCCACCACTTCGGTGTTTTTGTGGTGCAATCGAAGTTTGGGCTTGGTTTCATTGGCGTCCTGATTGTC
GTGATGTCCATCACGGCATCCATCGGCCTCTTCTCCTGGTTTGGCCTAAAAGCAACGTTGATCATTGTGGACGTCATCCC
ATTCATTGTTCTCGCCGTTGGCGTCGACAACATCTTCTTGATCGTGCATGAGTTTGAGCGGGTCAATGTCAGCCATCGTG
ACGAGGAGATTGAACGGCGAGTTGCCCTTGCTCTTGGACGGATAGGCCCATCCATCCTCTTCTCCGCCATTACCGAAACG
GTCTCGTTTGCGCTTGGTGCCTTTGTGGGCATGCCCGCTGTTCGCAACTTTGCCATCTACGCCGCGGGTGCGGTGTTTAT
CAACGCTATCCTACAGGTGACCGGTTTTGTCTCTGTTCTTGCACTGAACCAATTTCGTGTGGAGGACAACAGAGCCGATA
TACTGTTCTGCATACCAGTCAAGTCGGCTCGTGTGCACATCAATGGAACATTTGACGGCGAATATTCAAACAGGCGCAGC
AACGATGAGATATCACACGAAAGTATTCTACAGCGCTTCCTTCGACAGCGTTATGCCCCGGCTCTCCTGAAGAAGGGTGT
CAAGACAGTCGTTTTTGTTGTTTTCGGTGGGCTGTTTGCGGCTGCCATAGCGCTGATGCCTTTTGTCGAACTCGGTTTGG
ACCAGCGCGTCGCCATTCCTGACGGCTCATACCTTATCCCTTATTTCAACGACCTGTACGACTACCTCGACTTGGGCCCG
CCGGTGTACTTTGTTACTAAAGGCACGAATGCAACGCAAACATATTACCAGAGGGAGCTCTGCTCGCGGTTCCCCTCGTG
CGATCTCACTTCTCTCACCGGCATTCTTGAGCAAGAGCGCAAGCGTACGAATGTGTCGTTCATTGCATCGCCCACGGCCA
GCTGGATTGACGACTTCTTCCTTTGGCTGAATCCGGACTTTGAGGACTGTTGCGTCGAAGATGGCAAGCCCTGCTTCGCC
GAACGCTCTCCGCCCTGGAACGCACGCCTCTTCGGCATGCCAGAGGGGGAAGAGTTTGTGCACTACCTGAAGAAGTTCCT
CGCCTCGCCGACGACCGAAGAATGCCCGCTTGGCGGTCAGGCCTCATACGGCCAAGCGATCGTGGTTGATTCTGAACGGG
ATACGGTGCCAGCAAGCCACTTCCGGACAATGCACTCGCCCCTGAGATCACAGAGCGACTTCATTGAAGCGTACGCGTCT
GCACGAAGGATCGCTTCCGACATCACAGCGTCCACGGGCGTGGAGGTGTTCCCTTACAGCGTGTTCTACGTCTTCTTTGA
CCAGTACGCCTCCATCGTGTCGCTCTCTGGAGCGCTTCTTGGCTCGGCGATGGGGATCATTTTCTTGGTTTCCTGGGTCC
TGCTCGGCTCGTTCAGAACGGCACTGGTGGTGGCTGTGACCGTTGCCATGACTATCTGCGACATTACTGGTGCCATGGCT
GTGATGGGCGTCTCTCTCAATGCGGTGTCTCTGGTCAATCTGATCATCTGTGTTGGCATCTCGGTGGAATTTTGTGCTCA
CATTGCACGCTCCTTCACGTTCCCGTCCAGTCTTCTGCGGAACAACGCGCGAACTCGGTTCGTAGGTGCTCGTGATCAGC
GAGCTTGGGCAGCTCTGGTGAATGTCGGCGGTTCCGTCTTCTCAGGCATCACCCTCACAAAATTGCTGGGGGTGTGTGTG
CTCGCATTCACGAGAAGCAAAATCTTTGAGATCTACTACTTCCGTGTCTGGGTGGCGCTCGTCTTGTTCGCCTCGCCGCA
TGCACTTGTCTTCCTTCCGGTTGCGCTCAGCGTGCTGGGTGGCCGCGAATATCTGGATCCCGAGAACGAGGGCGGTCTGA
CGGCCGACCTCACAAACCGGGTCCGTGAAGCAGAAGACAGCTCGGACGATGAAGACAGGACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62