GenePrediction:GLEAN_8114 Details

Name: GLEAN_8114
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:978055..974143 (- strand)
Length: 3913
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:978055..977806 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_113:977735..974143 (- strand)
Length: 3593
>GLEAN_8114 class=GenePrediction position=GCSC_113:978055..974143 (- strand)
ATGAACACGTCGCGCGACCCGACCTCACGCCTACGTGCCACCCTCAATCCGCTCCGGACCTCTTCACTGGGCGTCCTACA
TGGGACAGCGAATACTCCATTGTCTGCTTTATCCATACCCTCTCATGGCACCCTCTCGGTGAATCAGACGCCACAAAGTG
CCATCCAGCCGTACAATCCACAGCAATGGGCTCCTTCACCTGCACCGTTGGACCGCGGCCACCACCACTTCCAGGACCTG
CAGCCTCAACGTGAGTGTTCAGGAGTGTGCTCGATTCATTGTCTGAAGACCGCCAGATGTACACCTACTAACAGCACAAG
AATCCCCCCCGCCTCCACCACCATATTCGCCGCCTCGGAGCCAACGACGGCCTGTGAGCGGAATCTACGAGACTTCTTCG
CCGGCCAACATATCTGCCGTCAGGGCACCTCTTCCCACTGGCCAACGACCATCGCCAGAGCCGTTTTCCGGCCAGCAGAG
CTTTGCACCACCTCCTGGCACCTCCCGAGGCGGCTCTCGTGAGAGACGGTTTGGCCTTCCGTCTTTTGGCCGTCGTCGCG
ACGCAACAGAGCAAGTGACAACCATCCCGCCATCTGATATGCACACTTTGACGCATCACGCACATATCCCACCTCGGCCT
CCACCGTCTCTGTCTCCACAACCACCACCGCCCCCAGTACTGCAACCCTTGCAGATCCCCAATGATGCTATCTACGGAGC
GACAGTGCCTCCTGGATCTCGCCGTGCTGCCTCGACAGGCGCCATTGGAACCCCGACATCAGCTCGTTCGCGCTCCTCGT
CGCAAGTGCGCTGGGAATCAGGAATGCCCATACCGCCACCGCCACCGGGGCCACCCCCATCCGGTTCCCGATCGCAGAGC
ATGAACAGAGCAGTCATGGATCCTGAACGCGTCGCGTCACCTCCGACCCGTCGGCCACCACCTACTGGGGTGGCTTCTCT
CGGCCCAATTCCGCCCACGCCGGCAGGATGGGTAGACCAGGAAGCTACGAGCACGCCTCGTGAGCCGGCCCAGGGACATG
GGGCAGAAGGCCCCAGGGCGCAGCCAGCAGGGCTGGATTATACACCCAACCGAAATTCCCTCGGGGAGACAGCTTCAAGC
GCCAACAGTTCAAGAGAGATGTATGAGTCTACCGCCTCGAGCAATTCGAGCACCAGTTCGCCCAACGCCCCGCATGCCGG
CAACAACTTGGCCCGGAACGGTGCCGTGCGCGGCGAGAAGACGCTCCGGGAACGGCGAAATGAAAGCCGAACACGAACAA
GCACGCGGGGGTCGGTGGATGAATCGAGCAGCAGCCAGCGAATGTCGGATATTGTGATTCCCTCAGCCGACTCTATCGGC
AGCCTCGTGCGGCGTCCCACCATAAACAAGTCGACTCCACGGAGCGGAGGTGGCCTAGGCAGCGGTCGACTAACTCAATT
TGACGGTACCCCCCGAACGGGCGATACTCTCACGGGTGGCAGCATCCCAGGAACGGCAACGCCACCCTTCTCACCGCACC
CAATGAAGAAGCGGCCGACGGTATCGACGCCAGGTCTTTACGCGGCGGGCGAGTCTCCCATGCAGCATGCCCCCCCGACA
CCTCCGTCTCAGAGCCGCTCAGCCTCTAAGTCGACGACGCGGCTACAGATCGACACGACAGTAGCTGGTGCCGATGACCA
CTATTCTGCGTCCCAACTGATCTCGAAGGAAACGGCCGTGCGACAGACAGGCGGACAGTTTAGTCGGGGTACCGTGGAGC
GCTTTCACCAGTTTGCGCAGAGGGAGGAGGCTGCCAGCTCCGATGCCGAGCGCGTGAAGCTATTTGCCGAGTTTGTGGTC
AGCGAGTCGAGGATCCGCCGGGAAAGGTATGCTGCTGCCATCGGGGTCATGGGCTCTGAGATTTTTGATCTCACCAGAGA
TCTGTTCCGGCCTATGGTGGACAGACGGCAGTCGGTGGTCTCGCAGGGCAGCGGCGGTGCCAGTGCAGGTGTCAGCGCGG
CGACCAGCGCTGTCGCATTCACACCGCAAACTTCAGAACCGAGCGGCTCCAAGCGAGGCTCGATGAACTCGGTGTTCCGC
GACAGCCCGTCGTCAGCTCCGATAACGCCTGGATTCTCCAGCATTGCGCTGGAAAAGGCACCAGTTTCAGCGGGTATGGA
GTCCATCGGCAGTGTTGGGAGTAGTGGCCCGGCCATGTCACCCACGGTTCCGCCTGCTGGGTGGCAGCAGTCGAACTACA
TGCCCTCGCTCTCGCCGATCCTCAGCATGAGCGTCAGCGAGCACCACGATGACAACAGCTCGCGAGGGCGGACGGCCAGC
CGCTGGTGGGAGTCTAGCTCCTACGGGGGTGATGGGGCTGGGCGACTGGAACGATCGAAACGCGAGTCAAAGTACATGGG
AGTGCCAAAGGAAGCCCGCGAGGCCTTGCAGTGGACGGACAACCCAGAGCCTCTGAGCGGCAACAGTCTGCCCGGGCCTG
CAGATGATGCCGGCCTGGGTATTGGTGGAAGCAGCAGCAGTTACTACCGCGCATACGAGAATTCCAGCGAATACCCGCTC
GAGAAGATCCCCGAGCCGCTACACACACCGCAGGCACATGTGCTCAACGCGCAGACATCGTCGCCGGCATTGACGGCACC
AAACACGCCTAGCGCCGCGCAGCTCGACGTGTCACGCCTGGTGACGCTACCACCACCGTACCCGCGCCACCACCCGGCTT
TGAGCAACAACCACCCGGAGCTGTCGTCGATCCGGTCAGCTGTTAGGAGTCTGTCGAGCTTGGCCGAGGTTGAGGGAGCC
AAGGAACGGTTTTCACGCGAAAGCCAGACAGCGCGCGACGAGGCAGCACGGGCAGCAGAAAACCAGAGGCAGCTCATGCG
AGCAAACCTGCAGAAGGAGATTGCAACCGGCCACATGAGCTATGCCGGGGCGGCAGCAGCAGAGGCAGAGGCGGCCGAAG
GCGAAAAGGCACAGCAGAAGGCACTGAATAAGGCAGAATTTGACCGGTTTCAAACGACGGTGGTGATGCCGGTCAACGAG
CTGGTGACAGGGCGAGTGGCCAGGGCAACGAAACTGTTCGACGAGCTGCGCGGGCGGCTGTTTGTGGAGACGCACGAATG
GGACCCGAACCTGCCGCAAGAGGAAGGCGACGAGCAGCCGGAGCTGCTGGAGAAGCTGACGCTGCTAAAGTGGATATTCG
AGGCGCGCGAGATGCTGCACCGGGCCAACTACGACCTGCTGACGGACCGCAACGACCGGTACCGTGACATGGTTTTGACG
CCATACCGACAGTCGGGCAACGAAGAGAAGCTGGCGGAGGCCGAGGCGTTTTTTGCAGACGACGTGGCCAAGCGGGAACA
CATGTTCGCGGTGGAGAGTCTGCAGCGGATGCAGGAATTCCGCGACGTGATCGAGGAGAACGTGTTGCGCGGGGTGGAGG
CCCAGCTGTCCGCGTTCTGGGATATTGCGCCGCCGCTGGGACAGCTGCTGGAGCAGATTCCGGGCGACCTGCACGGGTTT
GCGATCCGGGTACCAGCAGCCGAATACGACGAGACGCCGAGCTACCGAAAACACCCGCTGCAATACCTCTTCTCGCTGCT
GCTGCACGCAGAGAAGAGCACGCACCAATTCATCGAGTCACAGACAAACCTGCTCTGCCTGCTCCACGAGGTCAAGGAGG
CGACGGTGGCGGCCAAGGCGCGCGTGGCTGAGCCCGAAGGTGTGCAAAATGCAAAACAAGAGCGGGCTCGTCTGACGGAG
GACCTGCAGGACAAAGTGCGCGTGGTGCAGGACCAATGGCGCGCTGGTCTGGGCGACAGCATCGTCCTGGTCAAGGAGCG
GGTCGGCGGCTGGCTGCTGGAGACGGGCGGCTGGGACGAGAGTCTAGAGGATGGAGGGATAGGAAGTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62