GenePrediction:GLEAN_8116 Details

Name: GLEAN_8116
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:969419..967202 (- strand)
Length: 2218
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:969419..969342 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_113:969283..968882 (- strand)
Length: 402
Type: CDS
Source: GLEAN
Position: GCSC_113:968821..968504 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_113:968446..967202 (- strand)
Length: 1245
>GLEAN_8116 class=GenePrediction position=GCSC_113:969419..967202 (- strand)
ATGGAACCGCTCAGCTTCGAGGGCATAAAGTTCTGGATCTCCAAACACGTCCCACCGCTCATCAAGTTGGATGTCCGAGT
ACGTCTGCGCTGTTCCTGCTCGCCCTCTGAACTGTCTGTTCTGACCTGTTTCGTAGAAGCGAAAAGGAGAGATTGTCGTG
CTCGAGCGCGATGCCAACATCTGCCTGGTCGACCACAACGAGTACGTGGCCGACCCAGACCGCTTCTACTCGTACCTATG
GGTCAAAGAGTGCCTGTCCAAGAACGCGAGGGTCGACGAGTCGCGCTTCCTCGTGGCTGAACTGCGCAAGAGCATGCCGG
CTGCTTCGCAGACCCCCGCGTACGCGGCCTCGCGCGACGTGGCCCCGTCGTCATGCTCCGCCTACGATACGATCCAGGCA
CGGAAACGGACTCGAACCGGCTTTACAAACGAGGATGACAGGATCCTGGTCGAGTGGTTAAGGGAGAAAGCCGATTTTTC
CGAAGGAGCCAAAAATGGCGTCAAAGGCAACGAGATCTACAAGGATCTGGCCAGACAGGTTCGCCTGACTTTTCCATGCA
AACCCCAAGCGTCTTCCTGACTCGTTGCAACTCTGCAGTATCCCCACCATACCTTTCATTCGTGGCGAGATCGATGGGTC
AAGAAGCTGTCTAAAATCGTGGAGCACGACTATGTCACGAAAGGCAAAGCATCCAGACGAGTGCAACAGTCCTTGCAAGC
CCCCGTCGAACCAACATCAAGAAGAACAGTGTCGGCACCAGTGGCGGCGCCAAATGCACCGCCGCCCCTTACTCACGACG
AGCGAGTTCCCTTTCTGAGCAGTATAGACATGGCCATCATGAGAGGAACATGGAAAGAGTCCCGGACGGGCGAGAATAAA
ACCCAGGCCGCCTTCTTTAGATCCCTCGCCGTACAGGTATGTCTACCACGGCGGCGCTGCAGAAGATGAACGATGTCACT
GACGTGTCTGTAGTATCCGAAAGTCTCGATCGAGCAGTGGGAAGCCCGCTACAAACGCCTGCGCGCTTGGTATGAGAAGG
TTGACACGTTTGACCTAGAAGAGGACCGGCTGAGTGAGCGGCCATCGACAGCAGTAGATCCACCTGCCATGACGAATGCC
GCGAGCGGCGACAACCAAGCCATTGCGGCCAGCCACGACCACAACGACAACGACGGCAACGATAGGAATGGAGACCAGAG
TGGAGATGAGGATGAGGATGTTGAGGATGGCGACGTCGACTTTGATGCCAGCGCCTTGCTGGAGGAAGTCTCGGCACAGG
ACGGTGCACAGAAGCAGTTCCTTGGCTTTGTCGACTTTTTCAATGCCAACGGCGGCGGCTATTACATCCCACGAGCGTTT
GTCATTGGCGGCCGGCTACTCGACATATGGACGCTCTGGACGACAGTCCAGGACGTGACCCCTGACCCGAAGACGCGCGA
CTGGGGAAGGGTGGCGAGAGCGCTCAGCTTTGACACGGCCAAGCACCCGGCCGTACAGCATGAGCTGGAGATCTGGTATG
CCCATAACATGGCTGAATTTGAGGAGGCCCGCGCCGAGTTTGAGGCGGACGAGCAAGCAGACGGGCCGGAGGCCGTCATA
CCGAGCACACAGACAGAGCTGTCTGCCGGCGCCAAACGTCGTCTGGTGGAGGCTTTTGGCGGCGATGGGGACGAGGGCGA
GGACGAGGACGAAAATGCGGACGGCACCTCGGCCAGGACTCCAATTCGAAGTCACGATCGCAAGCGTGCCGCCCTGGCTT
CAGAAGTCGAGCTGCCATCGGACGAAGAGGACGACTCGGCCTTTGAGCGACGTTCGTCTGCGCCGGCAAAGACGGAAGCA
GGACGGAGGAAGACAGTAGAGCCAGAGACACAGGACTTTTCCTACGACCAGGCGAGAAACGAGGACGCCGACGAGGAGGA
CGAGGATGAAGGCGAGGATGGGGGCTCTCGGCCTGGCCTCCAGGTGACTCCTTTGAACCGGCTGCCATCTGCCGTCGGGA
CAATCGAGGCCGTGCCTCTATCTCTGCCCAGGCGAGCGGATTCGACCGGCGGTACCGCAGTCAGAGAGAGCCCGTCGGCA
TCGGCATCGGCATCGGCAGCAACACCGGCTCCGCAGGCGAGCAACCGGCGATCGCTTCCTGGATGGCTCACTCGCAGCCA
GGCGCCCATAGCGCAGATGATGACAAGCCCAGAGCAGCCGGACACGGTGCGGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62