GenePrediction:GLEAN_8118 Details

Name: GLEAN_8118
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:960806..958696 (- strand)
Length: 2111
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:960806..960495 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:960439..958882 (- strand)
Length: 1558
Type: CDS
Source: GLEAN
Position: GCSC_113:958802..958696 (- strand)
Length: 107
>GLEAN_8118 class=GenePrediction position=GCSC_113:960806..958696 (- strand)
ATGCAGCCGGATCTTGCTATTCTGAATGCAGAGCAATTCAACATCGGTGGCCGGATTCCGAAGGCGGGTCGAATTCGAAG
ATCCACACAACAAGAGATCTGCAGAGACGCACCCGACAGTCTCCAGGCCGCCCTAAGTGCGCAGCAAGTCGCTGGCATAG
ACTCGACCATCGCTGCATTTTCCAAGGTCCCTTCGGCTATGAAAGAGACACTGAAACGCGCTTCCACCGCTAGTGGTGAA
GATGGCGAGCAGGAAAAGAAGCGGGCACGAGGCCGTCCGAGAGTGGCCGTCAAGGACGTTACCGCAGCCGACGTATGCAC
AGCTCTGCTCCCCGACTGCTTTGTACCTACTGACAAAGTCGGAACAGAGACGGCGAACACAAATCCGACTGGCCCAACGG
GCCTACCGGAGCCGGAGAGAGAACGCCATCATGCTTCTCAAGAAGAAGGTGCAGGCCTTGAAGGAAGCGAATGAGGCCAT
GAGCAATGCTTTTATGAATCTCAATGACGCAGCGATCAGCTACGGCCTGGTCGATCAACATCCAGGCTTCGCTCGGCAGC
TTCACAGCACCACAGAGGTTTTCTTAGATCTTGCCCGGCGAGCCAGTGGAGACGAAGATGACGACAACGACGAGGACGAA
GACGCCGGCGACATGACCGCTACCGTCCGGCAGCCTACGACAACCACCAGCATGTCCAAGGAACAGCAGGTTATTGCGGA
TGCTGTGCAAGTGTTTGGCTACTCGACACGAGAGAGGTCCAGCTCGGCTGAGCAGGTTATGCCCATCTCGCATCACATGA
ACACAGCAGACGACACGCGAAAGCGGCCAACCCAGCTCTACGGAGGGGTCGTTGTCGAGTCTCCGGAGCTGACCGAGAGC
ACCATGTACTCGGGCCAGCAGACGGTGTATGACAACAGTGTTGGCTTAGCGACGACTGTGCCTAGCAGCAGCAGCAGCAG
CAGCAACTCACTCATGTCGATGACTCCAAACTACTACACCAACAACGAATCGTTTCACTTTGGCGGCCATGCAATGCCGA
TGTTCCCATTTTCCGGTCGGAACACACCGGTTCCAAATACATCCAACGGATTGGGTGCCATTCCAGTCAATCTCTATGGG
GGACTGACTCTCCCAAAGTCGTTTGCTTCCCTCGAAGGGACCTTTGGTCTCCGTCTGCTGCGGACCGCCCTCGAGAAAGC
ATACGTGTTGCTGTCTTCCCCGAATCCGCCACCGCACGAGTTCGCCCGCCTCTTTGGCCTGTGCGTCATGTTCGAGCCGA
TCGAGAAGATTCGAAAGCGAGTTTTCCATGGACTGGACCAGCCGTTAAATGCCACGCTATCAACTGAACGCTGGGGGCCG
ATCGAGGAAAAAGACGACTGCTGGCCCTTCACTTCCGACAGGGCCCGTAAGATCGAAGCCGAGGAACATGACCCTGAGCT
CTGGAGCTGTACCGACATCCCCGGATTCGAAAATTCCTTTTACGACTGCCACGGCACCGAGCTCTACCTGCGCCAACGGG
GCGTGCACATTCCCGCCGGGTCCGAGCGTATCATCGTCGAAGTGGATGCGGATGACTTTGGGGGCGTCGATAATTACAAA
GACAAATCCGTTGTGGCCAAGGCCATATCACACAGCCCCGGCAGCAGTCCGCGGGATGCACCTTTCGACTGGAACAGCGG
CAATGACAGCACGGTCCCTGTGGGCGGCAATGACAGTAACGCATATGCTCGCGAGGATGCCCTGCAATCCATGCTCATGT
TTACGCAGAGACAGGCGCCCTCGCAGCATACTGGAGCAACGTCTATCGACTTCGTCCAATTGTCCCACCCGCCTGGCCTG
AGCCCTTCTTGCTCCAGCAGATCTAGCAGATCCGACTCGGCTACCCGTCGTGCTGTAGCATTGGACGTGGATCGCTTTGT
TGAAGGTAAGCACCATTATTAAAGCGTTGCTGTAAAGTGTAAGATACGACAGCAGAGCATCATCGCTAATACAATAAACC
GCAGAGCTTTCCGTGCGGGCTACTTGCATTATCCGGTCGCCAGGCTTCCGACCATCTGACGTAAACGACGCATTCTGGAA
GGCCGCCCAGACTGTACAGGCTGCTTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62