GenePrediction:GLEAN_8119 Details

Name: GLEAN_8119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:955739..950179 (- strand)
Length: 5561
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:955739..955662 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_113:955588..955522 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:955465..955085 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_113:955023..952439 (- strand)
Length: 2585
Type: CDS
Source: GLEAN
Position: GCSC_113:952376..952163 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_113:952103..950179 (- strand)
Length: 1925
>GLEAN_8119 class=GenePrediction position=GCSC_113:955739..950179 (- strand)
ATGACGGCCCAGCTTCTCAATTCCGAGCTCGGCAACCTCATTCAGGAGAGCAAGCGCAAGCACAATGATCTCAAACTGGT
GCGACGCGCCCTCCTTTTTCCTGTTCCGGAGACAGGACGTGCTAGGGGACTGTGGCTGACAAGGTTCAAAGGCTTCCGAA
AAGTCTCTGGAGGAGCTAAGAAGCCTCAGAGACAGCTCCGAGGCGCACATTGGAGCAGGTACTGGCCGCTCCGTTCTTCT
TGTACGACGACTTTGACTAACCATGGCCCTGCAGAACTCTCCCAGTGCACGAACTTTGTGAACCCGTTCATCATCGCCTG
CGGCACGCGCAATGTCAAGTTCACAGGCATCGCCATCGTTTGCCTGCAGCGGCTCATTGCTGCAAAAGGAGTTCCGCACA
CGCGACTGGACCAGGTCCTTCAAGCGATTCGAGAGTCTTCCGCCGGTGGGCTAGATGTCCAGCTTCGGATTCTGCAGTCG
CTCCCGACCCTGCTTCAAAACTATGCCAACGAGGTGTCGGGCGACTTGCTTATTACTACACTGAACATATGCTTTGTCCT
CCAGACAAGCAAGAATGTTGTGGTCAACAATACTGCCTCTGCTACGCTCCAACAGCTTCTCATCTCGGTTTTCGACAAAG
TCGTAGCTGAAGATAGTGAGCCTCCATATCTATATAAATGACGGGGCGAAGAACCTATACTAATCGTCGACTGCAGAATC
CCCCCCTCAGACGCAACCGGTTGGCGATGCGCCACTGCAAGATGGCAGAATTCCGCTTCATGCTGCTGCGATGGATGCAT
ATCTTGTCTTCAATGATATTTGTCTCCTGACGGCATCTGGTCGTCCCGAGTACTTGAGGTTTTCCAACCTCTCGCAGACA
TTCGGCTTAGAGCTCATCGAATCTGTCTTGACTAATCATCCGTCCATATTTGCGTCCCATCCGGAACAGACACAGATTCT
TCGCTCGAGAGTCATGCCATTTATAACGAAGAGTCTCACAGGGAGGCCAAATTTCCCTACTGCCGTTCGCCTCGTTCGTG
TTATGTACACCGTCCTTCGGCGGCATATGACGCTCTTGGCTGTTGAGAGCTGCGAAGGGCTTTCGACCTTGGCCTACGTT
CTTGATCAAGAAACGGTCTTGTGGAAAAGAGTGCTCTGTTTGGAAGCTTTCAAGGGGATATTTTTTGACCCAAGTCTGTT
GCGTCTAATATACACGCTATACGACGATAAAGAAGGAGAGAAGAATATTTTACAAGACTTGCTCGCAACTTTTGTCCGGG
CGTCTACCGAGCGACCCAGTGTGATTGGCCTTGGACACCAGTCGACCATTCCCGTTGCCGGATCAAGCGTGGGTGGCGGC
TCGACGGCAGACCAGGCGGTGCTTGAGGCAAGCGGCGGCATCATCGGCGGTTCTGTCACGTCCGAGACGAACAGCACGGG
CATCAGCTCACAGTGGAGCGCAATACGAACGCCTTGTATCGACCAGCTAGACAAAGCTGAGCCTCTTACAATACCAGATT
CGTATATTTTCAGTCTGATCCTGGCTTGCATCACGTCCTTATCGGAAGGCTTGGCAAAGTTTATTCTCCCCCTTACTGTT
CCAGGCGAGGGCCGCGGTCGGAAGAAGAGCGCGAAGTTGGAGAGCAGCTCGGCTTCTACTGCTGCAGGTGGATCGTCGAG
AGATGACGTGTCCAGCGGCCTAGAACGGTCGGCATCATTCAAAAAAAATCCTGTTCCCCTGAACCCTCTTTTGCTGAAGG
AGCACCCTCAGTACTCGGAGGTGAAGACATGTGCAGAAATGATGGACAGCTGCTGGCCTGCTATATTAGCAACCTGCTCG
ACATTCCTGTACTCGGCATTGGATTCGGAGTATTATCACAGCTTGGTGCGAGCATTCCAGAGATTCACGCATGTGGCCGG
ATTATTGCAACTGAACACCCCACGGGATGCTTTTCTCACAACGCTCGGGAAAGCAGCCGTTCCTCCAAACGTGCTCACAG
CGTGTCTTAACGCGGGCCCCCGGCCGTCGACGCCGACGTCTGCAGGTGCCGATGGCAGCAGTATATTTAGCAATGCCCGT
GGCTTACTCAGCGTTGACAGCCTGGTGAGTCAGAACTCAGCATCTGACAAGCCACGACAGTCGTCGGCGGATGTTGGTGT
TACGGCTCTAAACACGAGAAATCTTCTGTGTCTTCGAGCGTTGTTAAACCTCGGCATTGCTCTGGGCCCTACATTGGAAT
CAGCCTGGCAGATTGTGCTGGAAACTTTACAACAGGCCGACTTTGTTCTGTTCTGTTCCGGGAAGACGCCAGGGCGAATG
CCAGCAGCTGTGAGATTGGCCGATCAACTGGCCGAAGCTGAGGCCAATACGCTTTTGATGAATTTCGGCTCGGAAATCAA
GTCTGTTGAGACGGCTGCGTCTCGCCTTTTTGAGAGCACAGTGGACTTCCCCAACGAGGCGTTTGTTTCGATTGTCGTGG
CCATATGTAGCCTCCTGGAGAAACGGACGGAGTCTGCGACACCGCAGGCCGGAGGCCGGCCGCAATCGCCAACGTCTCCG
ATCGGAGAGACACTGAAGCCTGCAAAGGGGGCAACTCTCAGAACACCCGTTGTTAAGCACCAAAGGGTGATGAGCATTTC
GTCTGCGCCAGTGTCAGGCTCCAGCCAGGAAGACCAGTTTGTATTGGCCAAACTGGGAGACGTTGCATCGATCAATATTG
AGAGACTCTTGTACAACCCACCAGACGTGTCGGGTTGGACACCACTCATTGGCGAGTTGGTCGGCGCGCTCAGCTCGACG
GCAGCAGCAGCAACCGTTCGAATGCGTGCTGCGGAAACGCTGGTGCGGCTTATTCTTGAAGCCACGGCAGCGGTCTCAAC
GGCAGAAGAAGACGTACGTGGCGAGATCCAGCTCCGGCTTCTGGAAGCACTAAAAGGCTCGCTTCTGCCACTACAACGAG
AGGACCGTGCAGGATCGGTAGCTACTCAAGCCATCGACATCGACATACACAAAGCGCTCCTCGACGGACTGAAGAGCCTC
CTCGAGGACAGCGGCGAGACGCTTACGAATGGGTGGACTGTGGTTTTCAAGTCTATCGACTCCATATTTGTGGAGCAGGA
GAATAAACGAGGAAAAGTGCTCAAGACAAGATCAGTGCGGTTGATCAAGTCGTCATTCGCTTCCTTGCAGCTGATATGTT
CGGACTTTCTTCCGTCGCTGCCAAATACCTGTTACCTCAACCTTGTCGACAGCCTGTACAAGTTTTGCTCCCAAGATGAC
GATCTCAACGTTGCCCTGACTGTGCGTTTCGACCCGTGTGCACCCCTTGCGCGATGCAGCGGCTAACATAGTTTTTGTGA
CAGACGGTGACATTCTATTGGACCATATCGGACTTCTTGTTGAGCCGCAACAGCTCGATGTCGATCACGGCAGCGATGGA
AGGAGGACCGAGCGACGACGCACTGGTGAAGCTGGCGTATAACACGTCGCACCCAGGGTCTGGAGCTGCTCTGTGGATGC
TGCTCTTGTTGCGGCTCACTGCGGTGACGACGGACCATCGGTTGGAGCTGAGAAACAGTAGGTCTCTAGCGAAATGTTGT
GTTTTTCTTGCACCAAACGCTGACTGCAGTGTCCAGGTGCTGTTCAGACACTGCTACGTATAATTCACGCCTACGGCAAT
AGCCTCAGTGCGGAGTCTTGGGCGGTATGCATCCGGGCGGTTATATTCAAGCTGCTGTCGTCGACGGAGGAGCAGCTGCA
GATAACGAGCGAAAACGGTGCGGGTACGGCGACTTTTACAGAATGGAACGAAACAGCTGTTGTGATTGTCAACGGGGTTT
CGGAACTGCTATCCAACTACCTGGAAGTGCTGGTACCGCACGAGGTGTTTCCGTCGCTGTGGCAAGACCTGCTCGAGCAC
CTTGCAACGATGCTGGACTTCAGGGCGCTCGACGTCAGCACGGCGGTTTTTGGAAGCCTGACGAGCATTCTGTCGAAGAG
CGACGGACGAGCGCGGCGGTCGTTTAGCAGTCAGGCAGTCAGGCTGGCATGGGAACTTTGGTCCCGCGGCGTTCCAGCGT
CGGAGCCGGTGGCAGATACAGCAAAGGCAGAAGACAACCAGAAATGTCTTTTGTCGTGGGTGAACACGTTTCTGGAGATC
GAGCGGCTGATGCGTGCAGACATGGACCTAGAGACAATTCAGCAGATGCTCGGGCTTCTGCGTGACGCGATGATCTGGGC
GAGTCCGGGAAGCTACGCCAACGACATTGAATACACGACACCGTTGCAAGGGCAGATTCTGGAGGTGCTGAAGATTGTCC
GGACGGACATCCACGGGGTGCCTTCTGCGGTGATTCTGTTGCTTGCGGACTTTGTGTCGATGGCGTTTGACTTGCCGGAG
GCGTCGGTGCAGCCGAAGCGAACATTTGTGGCCATGTCCAAGGCAAGCATGCCAATCCTCCACTACCACATTATGAAGAA
TGCATCGGAGCCGGACATCTTCAGCAGCGGGGCGTTTTCTCGAGCACTCACGGCGCTGGCGAAGCCGATTGGGCTAAAAT
ACGGGTTCCGAATCGTGACGAAGAGCATTCAGCCGTGGAAGGAGGCGGTGAAGGCGACGCTTGCGATCCTGGAAATCACG
CTGCCGCACCTGAAGGCGAAGACGGTGCCGAAGAAGGCATTCCAGGACGCATGGGACGCAGTGGTGACGGTGGCGAACGG
GATCATCAGCGCCAAGCTGGAGGAAGCGGCAGTGGAGGACAGCGTGATTGCAGACGACCAGCAGTTCGACATCAGCGCGT
TTCGAAAGCTGCGCGAGCTTATCATCCCGTCGCTTGGATCGGGGGCGGTGGCCGAGAGAACGAGAAAGGCATATGCTGAG
GGCCTGTTCCGGATATCGATTGTGCACGCGCCATCAGCAGCAGATGCATCGCTTCTCTACGGGCCCTCTGGAACGGACGA
TGTGGTTGCGGCGAACCTGAGCAGGCTGTACAAGCCGGGCAGCGGCCAGACGGTGGACCCGCGGCCGACGAAGAGAGCGG
ACATGAGCCGTGTCTGTCTGGACGAGCTGTTTGCGTTGGTGGAGGCGCACGAAGATGCGAGCGGGAAGCCGTCGATTGTG
GTGCAGCCACCGACGCCACGGGCGCCGCCTAGAGGGATGACACTGGCACCGGCAGTGATGGCAGGCAGGGCAGACAAGAC
AGAGACAGAACACGCGCTGCACGTGAGGCTGGCAAAGACGGCAGCTGGCTATCTGATGCTGCGCTGTGCCCTGACGATTC
GGGCGTATGTATCGGACCAGCCGTTGCGCGGACACATGCCACAGCCGCTGTCACAGCGACGCGAGCTGTACCGCATCCTG
CGACAGCTGGTGAGCCTTCGGTCGGAGCCGGGAGCCATCCCAGAACTGGACGGTGTTGAGAGCGACGGGCGAAAACACCT
GCTGCGATTGTATCCGCTGCTGCTCAAGGCGATGCAGGTGGCCGGCACGGCTGGTGATGACAAGACGCTGGTCCTGGCCG
GAGAGGCCCTGGAGGCCGTGGGCACAGAGCTGGGCGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62