GenePrediction:GLEAN_8120 Details

Name: GLEAN_8120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:942068..938554 (- strand)
Length: 3515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:942068..941897 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_113:941385..940262 (- strand)
Length: 1124
Type: CDS
Source: GLEAN
Position: GCSC_113:940200..938554 (- strand)
Length: 1647
>GLEAN_8120 class=GenePrediction position=GCSC_113:942068..938554 (- strand)
ATGCTCGTGCCCCCAAACGACGGCACCGTCGGCCGGAGCGGCGTCGTCGAGCCTGGGTCTGCGAGTAATCCTGAGTCTGG
CCAGCCGAGAAAGCCCGGCAGTTGTCCCGGCTGCCAGGAACGCCTCCTCTCTGACCAGAACAGCCTGGGCGTGCACGCGA
ATGTCGCACTCGGTAAGGATCCTTCTCTTCTTCTTGCACGAACAGCCGTTGTCGGCCCACTTTGCCCGGCTTCGTTGCCT
GCATGGCGGATGCCTTTGTTATACTTTTCTTGTCTCCTCAGCCAGTGACGGTCTCGGCCCTCGTCTGCCCTGCAACCTCG
CGTCTTGCCCCTGCTTAGCTGCGTGTCCGGTCAATGTGCTCCATCGGCGACCGTCTGGGGCACAGGATCTGGGCCGCTAA
GAGTGCCACTAAATGCGCCCGCTGGAGCGCTGTAAGTTTGGCGCCAATTAGCGGGCTGGTAAGGCTGGACCCACGCTAAA
GCAAAGAAAATGCTGAACCATTACGAGCTCCGCTCAGCGGCTGGCGTCATTTGCACTTCTGACTCCTCGCCGTTTTGTCC
TCGACCGTCCTCGACCTTCTTCCTGCCACGTTCCCTTTGCATTTCTCTGCTTTCCGTCTACGACGACCCAGCACGATACG
CGCGATCCCTCTCCTCTACACGCACACGTCTAATCCCCGACAGACACGGCCGACGCAATGCCCACCGCCCCGTTGCCCCA
GGATTGGCCTCCTTCATTGGCCATTGCCGACGGCGAGGGAACGACTCGGGGACCCAGTCTGGACCGCGTGCACGATCTCA
AGCACGACAGCTCTGTTCTTGCCATTGCTGTGAACGACGAGTACGTATTCGCCGGTACCCACGACGGCGAGATCCTCATC
TGGGCTCTCGGCCCTTACCAGCCGGTCCACCGAATCCAAGCCCATAAACGCAGTGTCCTCTGCCTCTTTCTCACGCCTCC
TCCTCCGTCCTCGTCGTCAAAATCAAAACCCTCGACCACCGCATCAGACCCTGAGCCGAGCTTGGGCCAGTTTCTGGTCT
CCTCGGCTGGCGACGCCATCATCAGCATATGGAACCCCAAGACCTTTGAACGACTCTACGAGATCTACAGCTCGTATGAT
GTGGGCGACATCTTCAGCGTGGTCTATTCTGTCCAGCACCACACCGTGTTTGTCGGGGCGCAGGACACGTCCATCCAATG
GGTTGACCTGAACGATCCGCGACGCCGCGCCATCCAGGACTCGGCCCAACATCCGGACAAGAGGCACCACCGCTTCTTCG
ACTCCAAGGCCATCGGCGGCTCTAGCACACCGCGCCGTAACGAGGAGCGCTGGAGCCACATCCCCAAGGCCCAGACCGTG
CTCGAGGCCCATCCGAGCGCCATCCACCAGTTTGCCCACTACGGCTACGTCTACTGCATGCTGGTCGCCAAGGGCCCAGC
CCACAACCTGCCGGCCGACGACGAGGTGCTGATTTCCGGCGGTGGCGACGGTACTGTCAAGGTTTGGAAGATTGGCTCGG
CCGCCGACCACGATGGCAGCGGCAGCGACGGCGAGAGCGACAGCGATGAGGTCGGCCACGGCATCAGCGAGGTCATGACC
TTGGGCAACGACGACGCCATGTCCGTCCTCTCGCTCGCCATCGACGGCTCCTTTCTGTACTGCGGCAAGCTGGATGGACT
TGTCGAGCTCTGGGACCTCGACACGCGCCAGAAGTTGCGCGTCATCAAGGCCCACAACAGCGACGTCATGACTCTGCAGA
TGAAATGGGGCTTCCTATGGAGCGCCTCGGCGAACGGGTTTGCTGCAGTATGTTCCCTTGTCTACAGGCCTGCTTACGTC
CTGTTACACCTCTTCTGACTCTTTGCAGAAACACAGCACAGTCCACTACGGCACGCCCACGTCATCCTCCGACACGGTGA
GCCAGAAGTACCAGTGCATCAGTCGCTGGAAAGCCCACGACGGCAAGATCCTGGCCTCGGCCACGACGACGTTCCAGAAC
AGCCAGCTCTTCATCACCGGCGCCAACGATGAGATCGTCAGCATATGGCGGATGCCGGACCAGTGCTGCTCGGCTGACCA
GGAGGCAGAGGTGTCTGAAGACGTGATGCTCAAGAACCTGCGCGACTTCATCTCCTACAAGACGGTGTCTTCGCGTCCCG
AGTTCGCCGAGGACTGCCACAAGGGCGCGACGTTCCTGTGCACGCTCTTCAAGCGGCTGGGCGGCGAGGTGCAGATGCTG
ACAACACAGGACAAGCAGCACAACCCGGTGGTGTATGCCAAGTTTGCCGGAAAGCCGCAGCCCGAGGGCGGCGAGGCGCG
GCGTAAGCGCATTCTCTTCTACGGGCACTACGACGTGGTGGCAGCCGACACGAAGAAGGGCAAGTGGACGTCGGACCCGT
TTGCGATGAAGGGCGTCAACGGCTACCTGTACGGGCGCGGTATCAGCGACAACAAGGGCCCCATCATGGCGGCACTGTAC
GCGGTGGCCGACCTGATGCAGGAGAAGCAGCTGGAGTCGGACATCATCTTCCTGATCGAGGGCGAGGAGGAGGCCGGGTC
CCGGGGCTTCCAGGAGACCGTGCGCGAAAACCAGACGCTGATCGGCAATATCGACTACATCTTGCTGGCCAACAGCTACT
GGCTGGACGACGAGACGCCGTGCCTGACGTACGGCCTGCGCGGCGTGCTGCATGCGACCGTCTGCGTGGACTCGCCACAT
CCAGACCTGCACTCGGGCGTCGACGGGTCTTACATGATGGCCGAGCCGCTGAGCGACCTGACGGCCGTGCTGGCCAAGCT
CAAGGGTCCGCGCAACCGCGTGATGATCCCGCATTTCTACGACGGCGTGCTGCCGCTGCGCCCCGACGAAGAGGCCCGCT
TCGACGCCATCACGCGCATGCTCGTGCGGCGCTGCCCTGAAAACGGCCCGGCCGAGCTGCTCAAGGCCAGCCTCATGTCG
CGCTGGCGCGAGCCCAACCTGACCATCCACCGCTACAAGGTCTCTGGGCCCGACGGCAGCCTCGTCAGCTCCCACGCCTG
CGCCAACATCAGCCTTCGTCTGGTGCCCGGCCAGGAGCTCGACGATGTCATCACCGCGCTCGAGTCCTTCCTGGCTGACC
AGTTCGCCCAGCTCGAGTCTACCAACCACTTCAGCATCCACATCGACAACAGGGCCGAGCCCTGGCTCGGCGACCCTGAC
AACTACATCTTCCGCACCCTCGAAGAGGCCGTCATCCGGGCTTGGCACATGGACCCCCCGAACGACGACAATGCCGCTGC
AGCAGCTGACGGACAGAGCTCGTCTGCCCCGTACAAGGCCCGGCGCCCGCTCTACATCCGTGAGGGCGGGTCTATCCCGG
CCATCCGCTTCCTCGAGAAGCAGTTTGGCGCGCCGGCGGCCCATCTGCCCTGCGGCCAGGCCAGCGACGCTGCCCACCTG
GACAACGAGCGCCTGCGTGTGGTCAACCTGGAGAAGAGTCGGGAGATTTTTAAGCGCGTGTTTCAAAAGCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62