GenePrediction:GLEAN_8122 Details

Name: GLEAN_8122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:928983..927847 (- strand)
Length: 1137
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:928983..927939 (- strand)
Length: 1045
Type: CDS
Source: GLEAN
Position: GCSC_113:927875..927847 (- strand)
Length: 29
>GLEAN_8122 class=GenePrediction position=GCSC_113:928983..927847 (- strand)
ATGGCGTTTGCTGCGCGCCATCTGCATGCTCTCGGTGTACTTCCGGCTCGGAACAACGCCGAAGAGGCCATTGCTGCTCT
TGAGGACTGCAGCATGAGCAGTCTACGCCAGCAGCTGACAGAGCCCAGCTATGACCAGCACGCCGTTGCATTGGCCACGA
CGCGAACTCTGTGCCAGGCCCAAATCTTCGCGGCTAGCCATTCGTGGCGAACACATCTCGAAGGCGCGCGGGCCATTCTT
CAAGCTGCAAGCTGCCCGCATGCTAGAGTGACAGACACAACGGTAGCGAATGGCCGTAGTGCTTCCATCCATGACTTCCT
CGCGAGCTGGTACAACAATGTCGAAGCCCTGGTTGCCCTCACGCCACTGGGACTGCACCGAGGTCAGCTTGAGATGGCGA
GCAGTGGCCTCAGGAATGGAAAGGTGTATTTCGACGTGTTTGGTGGTGTCGCCTCAGACCTCCCCGATCTCTTCCGAGAG
GTTGGCGCCCTGGTGATTGAACGTCGCCGACGGTTCAAGTGCCAAGAGCGAAACGAAAACAACGTAGACTCCATCTTAAC
GGATGACGACATCGCCATTGAGGCCGAAGCGCTAGTACATGAAATTCATGTCCGCCTGAAACGGGATGCTGTGGGCCGTC
TTTGTCTCGATGGTGAACAGGCCTTGTCGCTCTCACACGACATCATGCACGATTACGCCCTGAGTAATGCTGGCTTCTTG
CATACGGCTCTGCTGTACATCCATGGCGCCGTGCAGTGCCTACCCATGTGGGCACCGGAAGTACGTCATTCTGTCCAGCA
GATCATCCACTGCTCAGAAAGTATGAAGTCCGCCTCGGCTCTGTCACCTCGAGTGCTGATGGCCACGCCGCTGTTCACGG
CCGGCCTCTGGGCGTTGCCTGATGCGCGGGTTGCCATAAAAAAGGCCTTTGAAATTATGAGCACGTGGATGCGGATGCCT
CACATCACGCGTTCGTCCGCTCTGTTGGAATACGTCTGGAGCAAGACATCCGTTTCACAACAGCACGATGTGTTGACCTA
TCTAGGTGAGCTGGAAAATATACGTGTGTTTCGACAAAAATATTTACTAATGAATGGCATATTAACAGAGGAGAGTCCCG
AATTTCTGCCGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62