GenePrediction:GLEAN_8123 Details

Name: GLEAN_8123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:924885..923041 (- strand)
Length: 1845
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:924885..924291 (- strand)
Length: 595
Type: CDS
Source: GLEAN
Position: GCSC_113:924220..924021 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_113:923949..923536 (- strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_113:923100..923041 (- strand)
Length: 60
>GLEAN_8123 class=GenePrediction position=GCSC_113:924885..923041 (- strand)
ATGGATAAGCCTTTTGATACAACGTCTTCCGCCGAGGAGAAGGTGCCGTCGTCGAATGACCCCAGCCGGTCTGTACGGCT
CGATCCTGCGGGCAATCTGCTCTCACCTACGCCGACCAGCGATTCTCTGGATCCTCTGAACTGGTCTGTTTGGAGAAAAT
ACACGTGTATCTCGATCGTGTGTTACTCCTACTTTCTCATGACGTACTTGACAACAGCTCCTATTCCGTCTTTCTTTTTG
CTTGAGGATCAGTTTGACGCCTCGTACGCCGAAACTAACTGGACATTTGCGATCTCGGCCTTTGGTCTCATATTTGGCCC
ACTGCTGACCGGTGGTGTGGCCGATATCTACGGACGGCGCATTTGCATGATCATTACTACAGCTGTGGCACTTCTTGCCT
CAGGCTGTACATCTATCCACGGACAGAATATAAGTGCCTACATGTTTGAGCGCTTTCTACAGGGGGTTGGTGCGGGCTCT
GCCTGCAACCTTGGGCTCAGCATTATCAACGACGTGTCATTTCAGCATGAAAGAGGACAGAGGGTTGGATTGTGGGCCAT
GTCTGCCAACATGGGCAGTTTTCTCGGCGGTGTCTGTAAGTTACCAGAGCAGTACAATAGAGGAAGGGGATTTGATATAT
ATGGCCACTGACACGTCAATTTCAGTTGGTGGACTCGTTGTTTCGGTCAACCAGTATTGGGTCGCATACCACGTCACGAT
AGCCTACGCCGTTTTGTTTGTGCTCACGGTTTTCGCTCTGCCAGAGACTTTGTACCCTCGGCGACACATGATCGAGCTCG
AGTTTGGACCGAGCAATAATGCATCTGAGGAGACCATCCACAGGACACGGGATCTGCCGTTTATTGTAAGTTGTAGTGTG
CATTGAGTTGGCTTTCTCTCAGTTTGTTTCATCACATCTTACCAGTCACTATCTAGAACATCCGTCGAATCAAAGGGCTT
GTCTACCCAAAGATTTGGGCACCCTGGGTTGTGGTCTTCAAGCTGTGGGGCTACCCAAACATCGTCATCAGCATCATGGC
ATATGTGTACGGCCAATATTGGTGGATCGTCTCTGTCATGACAGTCGAGCCTCTGGCCTACGTGACCGACACCCCGCAGG
TTCAGGGCCTTCTTTTCATTGGTCTTCTTGTCGGCGTCTTGTTCGCCGAGGTATTCTGTTCCGGCCACGCCAGTGACAAG
CTTGTCATGATACTGGCGAGACGCAACAACAGTATACGACAGCCGGAGATGCGCCTCTGGCTCGGCTATCCAGCTGTGTT
CCTGTCCGCCGTTGGCCTGATTTTATGGGGCATCTCCGTGGATCGTCACTGGCATTGGATGGTCGGCCAGGTGGCCTTCT
TCCTGTGTACGTTTGCGATTCAGCAACCTGTTCTTCTTTCCCATGCTGACATTTCGCAAAGACGCTGCTGGCCTGCAAAT
TGGCAACACCGTTGTGACAACCTACATGGTCGACAATTATCCTGCTTTTGCGAACGAGCTTTCCGTTTTTTACTCATGCA
TTATCAATGTAAGTTCCCCTGGAGTGTACTCATACGATTTTATCCAGGCAATGAAAGGGACTAAAATCTGGACAGCTTTC
GGCTTTCTTGGTGCCCTGGTTTATCTATAATTGGACCGAATACAATGGTACATTCAGTCCTTTCTCAGCCACCGCAGTAC
TGCTTTTCAGTACAGCTGACCTTTAATATAGGCTATACCTGGAGCTTTGCTATCCAAGGCATCCTTTGTGTGGTTATTGT
CATCCCAGCGTATATAATTTTGCAGATATTTGGACAGCGTTGGAGGAAGCCAGCCAACTTTGGTGGCTTTGAACTGGACT
CGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62