GenePrediction:GLEAN_8124 Details

Name: GLEAN_8124
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:916759..915343 (- strand)
Length: 1417
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:916759..915973 (- strand)
Length: 787
Type: CDS
Source: GLEAN
Position: GCSC_113:915898..915656 (- strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_113:915595..915506 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:915401..915343 (- strand)
Length: 59
>GLEAN_8124 class=GenePrediction position=GCSC_113:916759..915343 (- strand)
ATGGGTTCCATCCTTGCCGAAGAGGTCTCCGTCTTCGACCACGTCGATTACATCCCTCCCGACCCGATTTTCGAGCTCAC
CCTCACCTTCAATGCCGACAAGGACCCACGCAAGGTGAACCTCGGTCAGGGCACCTACAAGGACGAGCATGGCAACCCGT
GGATTCTGCCCTCGGTTCGCGGTGCCAAGGAGAAGATCCGTGATGCCAACCACGAGTATCTGCCCATTCTAGGCCTTTTG
CCCTTCCGAACTCATGTTACCGAGCTGGTGTACGGCAAGGACTCACCGGTCGTGTCTGAGAACAAGGTGGCCGCGAGCCA
GTCATTGTCCGGGACCGGGGCCCTGCATCTGGCAGGATCTGTTCTGTACCAGACACTGCCAAAAGACACTATCGTCTACA
TCAACAACCCGACCTGGTCCAATCACCGCCAGGTTTTTGAGACCATTGGCTTTGAGGTACGCGACTTCCGCTGGTCCTCG
CCAAAAACAGGCAGTCTGGATCTGCTTTCCATCCTGGAAGACTTGTCTCAGGCGCCACCTCTCTCGCTTATCATCCTCCA
CGCGAGCGGACACAATCCGAGTGCCTGTGATCCCAGCAACGAGCAATGGCGCCAAATTGCCACGGTGATCAAGGACCGGC
AGCTGCTGCCCCTGTTTGACGCAGCCTACCTCGGCATAACGTCTGGCAGCTACGAAGCGGATGCCTTTGCCATCCGGCAT
TTTGTAAACGACCTGAAGCTAGAGACTGTCATTTGCGCATCGTTTGCTAAGAACATGGGTCTCTACGGTGGGTTTACACG
GACATTTATTATTGCACAGGAGAGGAGTTTCAGCCAAGCTAACATGTTGATGGGCATCCAGGTGAGCGAGTTGGATACGT
TTCCATGGCCACGAAAACTGCGGCGTCGGCCAAAGCAATGCAGTCAAGACTCGCACAGCAGACTCGCGCCGAGATATCGA
ACCCTCCCGCCTTTGGTGCCCGCATCGTTGCTGCGGTCCTGGCCGATGACGAGCTGCGTGCCCAGTGGGATAGAGACCTG
ATCAAGATGAGCTCGCGGATCTCCGGCATGCGCACTGCGCTCTACGAGGGTCTGAAGAAGCGAGGTGAGAATCTTTGCGC
TCCTGAATTTCCTGCGACATTATCGCTCACAATGACACATCTAGACACCCCTGGAGACTGGAAGCCAATCATGGAACAGA
AGGGCATGTTTAGTGTCTTGGGGCTTCCCCTTGCAAAGGTTATGGAGCTAAGAGGTAAGACCAGAGTCTGCTGTCCAATG
AGGTCCAATGCTAATTTCCATTACGTGCAGAGAAACATCATATTTACATGGCAGATAGCTCTCGGATATCCATTGCAGGG
TTAAACGAAGGAAACGTGGAATACGTAGCCGCAGCGCTAGATAGCGTACTTCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62