GenePrediction:GLEAN_8125 Details

Name: GLEAN_8125
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:915170..913980 (- strand)
Length: 1191
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:915170..915077 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_113:914821..913980 (- strand)
Length: 842
>GLEAN_8125 class=GenePrediction position=GCSC_113:915170..913980 (- strand)
ATGGCGCAGATATGTGGTGGAGATGGTGGAGATGCTGGAGATGTTGGATACGATGGAGACGGTGGATACGGACACTGGGG
AGGTGGAGGTGGAGGTAAGTGGAGGAAAACGAAGGAGACGGACGGATGGAGGAAGTGGAGGCTTGACTGGAAGGTTCTGA
TACCATCCGGCACTGTCAACACAGTAGAGTTTGGAGGCCGAGCGACTGAAAGCAGCAGAGAAGCGACGTTCACGATCTTG
ATGTAGTTATTTAATTTACTTGAATCTATATTAAGTCTATGTGCGGAGTATAAGATGATATCGGCAACCCAAATCTGTCT
AGTTTCCTTGTCTGCTGTTTTCACTCCAGAAAGGAAGACCGGCTTCCAATCGGGCTGTGCCATACAGAGAAGAGCTGTCC
AGGGACTCGCCAGCGTACTCGCGGGCAGCTGTCATGCGAGCCAGGGCGGTCGAAATTGTAGGAAGGGTGGTGCCGTTGTC
CTTGGCGATGGAAACGGCATGGCGAGCGTCCTTGGATGCCAGATCGACGCCAAACCCGGGCTTGACGTCGAGTGGCGGTG
CGTAAGCGCCGGTAGTCATCCGCTTCGAGTAGCTTTCGAGAACGGGCCCGAACATGCTGCCGATGAACTGTTCCATCTGT
GCCGTGCCAAGACCTGTCTTCTCGGCAAACACGTGTGCTTCAGCCACGAGTTCCTGGAGCCCGATAACGAAGATGTTGCT
GCGACAGTGACCATTGTTAGCTTTATCAGTATCAGACTGGCCGATCCCATCTCGTTCAGCACGTACCCCGAGATCTTGAG
CAGGCTCGACTTGGACACATCCTCGCCCATGTTAATGATCTGCCGGCCCATCACGCCGACGACGAAGGGGGTGAGCTTCT
CGATCACAGCGGCCGGGCCAGCCATGGAGAAGATGAGCTGGCCAGAGGCGGCGACCGGACTGGCACCGAAGACGGGTGAG
GCCACAAACGTGGCTCCCTTTTCCCCGAGCCGCTTTGCGCACTTCGTGCTGGTGTCCGGGTGGACGGTCGAGGTATCAAC
CCAGATCTTGCCCGCGAGGGAGGCAGAGCTGGCGAGAGCCTGGCTCACGAGGTCGTCGAGAACCTGGTCGTTGGAGATCT
TTTATCATGCAATTAGAATGCGGGTATCGCGAGAGAAGAAAGGCGAGTGGAGAATAGACTCACCATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62