GenePrediction:GLEAN_8126 Details

Name: GLEAN_8126
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:913293..909768 (- strand)
Length: 3526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:913293..913011 (- strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_113:912947..912490 (- strand)
Length: 458
Type: CDS
Source: GLEAN
Position: GCSC_113:912421..911789 (- strand)
Length: 633
Type: CDS
Source: GLEAN
Position: GCSC_113:911729..909768 (- strand)
Length: 1962
>GLEAN_8126 class=GenePrediction position=GCSC_113:913293..909768 (- strand)
ATGGCTCTTTCCACTACTGACACGTCCTTGGCGGGCGTTGGCTTTATTGGCCTCGGGGCCACGGGTTTCCGGATGGCCGA
GCAACTCATCCAGGGCGGCCGCTATGGCGTATGGGGCTTTGACGCCGATCCGTCCAGCATGGCGCAGCTCTCTGTGCGTG
GAGGGCATGCTGGCACTTTGCCAAAGCAGGTCGCAGAGCACTCTCGCTTCTTGGTTTGCACTGTGGCCAGCGAAGAGCAA
CTAGGCGACGTATTGTTCAATAACGAAACCGGGGCGCTTCTAGGTCAGTAAGAAACCCAAAGATCTCCATTCAGGACTAG
CAACTGAGACGAGATTGGGCCGATAGCTTTGCCAAAGAGTGCCACTATCCTCATCTGCTCGACAATCCCCCCCACTTTCT
ACGACGGACTCCAATCTCGGCTTACGCTCCACGGCAGACCTGATGTGCATGTGGTGGACTGCCCCATTTCTGGGGATGCC
ATCATCGCCTCGGGCACTGCAGAGGCCCTCACAGACGCAGACGGCTTGCTGCGCAGCATATCAGCAAATTTGCACGTGAT
CACGGGGGGGCTTGGCACGGCGAGCAAGGTCAAGTTGGTCCACCAGCTGCTGGTCGGCACACATGTTGCTGCAGCTGCCG
AGGCCATGGCTCTGGCTGCCAAAGCCGGTCTGGACACCCGTGAGGTATACGACATCATCATCACGGCGGCCGGAAATTCA
GGGGCCTTTGAAGATCGGGTACCGCGTATGCTCGATTCGAACTGGACGACTGTCTCTGCTTTGGATACGTTTGTCCAGGA
TATGGTGCGTTTATTTCACTGTTTTTTCCCTCTGGTCTACGTCATCCCTCAAAATCGCTAACTGTCTCGCAGGGAGTTGT
AGTCTCGACTGGTCGCAGTCTCGGCTTCCCTCTTCCCCTGGGATCCACAGTCGAGCAGCTGTATATTGCCGCCTCTGCAG
CCGGCTACGGAAGAGAAGATGATGCTGGACTGGTGCGCATGTTTTTGCCACAAACACCGGATGCGGTTCACAAAAGCAGC
AGCGCTCCAGGCGGCCGCAGACAACTGGTTCCAGCTACGTCTGGCTGCCAGATCAGAAAGATCGGCATGATCGGCCTCGG
TGCCATGGGCCAGGGCATGGCCGCATCGCTGCTTCGTGCTGGATATGCAGTCCACGGCTTCGATATCTTCCCTGCGGCCG
TTGACAAATTCTTGGCACATGGGGGTCAGGGCACTCGGGCAGACTGCCCAGCTGCAGCTGCACGGGACGCCAACGTCGTC
ATTCTCATGGTGCAGAATGCACTTCAAGCCGAGGATGTTCTCTTTGGGTCGGGAGAGGTGGTCAAGTCGCTTCCCGACGG
TGCTGTTGTGATCCTGAGTTCTACTGTGCCGCCGCACTTTGTCCGTGGCCTGCAGGAGAGGCTTGATGGCCTGAACAGGG
GCATCTCTCTCCTCGATGCACCCGTCAGTGGAGGTGTGGCACGAGCTGCGTCTGGAAACCTTACAGTACGTCTTGAAAAC
TGTTCACGGTCATTCTGTCGCTAATTTGAGCCGTTTGTCTCTAGATCATCTGCTCAGGAAACGAATCCGTCGTGTGCCAG
ATCTACAGTCTTCTTATGGCCATGACAGGAACCGAGGACAACCTACGGTTCGTGCAAGGTGGCGTTGGTGCAGCTTCGTC
CGTCAAGTGTGTCAACCAGCTTCTTGCCGGTGTTCACATTGCAGCAGCAGCCGAGGCTATGGCCCTCGCGTCTCGTCTGG
GCCTCGATATGAGGTCTGTCTACGAGATTGTGAGTAGCTCGGCTGCCTGCAGCTGGATGTTCGTCAATCGTGTACCACAG
ATTCTGGACAACGACTGGACTCCGCACTCTGCTCTGGCCATCTTTGTCAAAGACCTGGGTATTGTGTTGGAGGAAGGCAA
GCGCCTTGGCTGCATCTGCCCGGTCTCTGGTGTGGCACACAACTTGTACATCGCAGGTGCTGCGCATGGACTCAGCCGCG
AGGCAGATATCGGACTTGTTCGCTTGTGGACGCCGGCAAGAGATGTATCTGTGGCGAAGGGCCTCCCAGAGGAGCCAGAG
CCGAAGTGCATTCCCCTGCAAGAAACTCTGAAGAGCCTGCCTGCGGAAACCATGGATGATGCGCTCGGTGACATTCGGAC
GATCGTGCAGAACAGAGAGGTTTCCACCCTTGTCGTGCTCGACGATGATCCCACTGGCACTCAGACATGTCATGATGTCA
ATGTCCTCCTGGTGTGGGACGACCAGACGCTGGACGATGAGTTCGAGCGAAACCCCACCGGATTCTTCATCCTCACCAAT
TCTCGTGCGCTTCCATCTGCTGCTGCCCGCAGCCTCCTGTTCGAGATTTGCGGTCAGGTAAAACGTGCCGCAGAAAGAGC
CGCAAAGACGGTCGACATTGTCCTCCGAGGAGACTCAACCCTGCGTGGCCACGTTCTCGAGGAGATACAGACTGTCGAGG
AGGTTATGGGGCCCTTTGACGGCTGGGTCATATCCCCGTTCTTTTTTCAGGGAGGGCGATACACCATTGACGACATCCAC
TACGTTGCCGAAGGAGAAATGCTCGTGCCCGCAAGCCAGACTCCGTTTGCTCAAGATGCAACCTTTGGTTACAAAAACTC
TAATCTGAGAAAGTACATTCTGGAAAAATTCCCTTCACAGCTCAACGAATCTTCTCCTTTCCTCTCCATCACGATTCAAG
ATATACGGGTCGGTGGCCCAACGGCCGTGATGCAAAAACTGCTAGCCGTTCCTCCGAAAACAAAACCGGTCATCATTGTC
AACGCAGCAGCAGAAACGGACATGCATGTTCTTGTCTCTGGTCTCCTTGCGGCTGCAAAGACTGGAGGCAAGCGCTACCT
ATATCGTGTGGGCGCTGCCTTTGTGTCGTCTCGTCTAGGAATTCCCCCAATTTCCCCTCTCGGTCTTTCAGACCTTGTGG
GCCCAGTAGAACCAGGCCATCCCCCAGCTTCGGCAACAGGTGGTCTGATTGTTTGTGGCTCTTATGTGCCCAAGACGACG
GCCCAACTGAAAGTTCTGCTAGAGAAAAGGGGACACGACCTTGCAGTCATCGAGCTCAATGTCAACACCTTGGTGGGAGA
CGTCGAAGAAGCCGAGTCTGCAGTGGTCAAGGCTGCTGAAGAGGCAACACGCACGATCAGCCAGGGTAAAGACGTCCTTG
TAATGACGTCTCGGGCTCTGATCACTGGCACAGATGCTCTTGGCATAGGATCCAGGGTGGCAGCTAGCCTCGTTCGTGTT
GTTGACAGCATCAGAGTGCGGCCGCGATACCTGATTGCAAAAGGAGGCATCACGTCTTCAGATGCGGCCAGCAAGTCTCT
CCTCATGCGGCGGGCTCGTGTCCTAGGCCAAGCCGTCCCGGGGGTGCCGATCTGGAGGTGTGACGAGGACACAAGCCGAT
TCCCGGGCATTCCGTACGTAGTATTCCCGGGAAATGTTGGGCGTGACGACACTCTGGCAGTGCTGGTAGCAGATTGGGCA
GCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62